Class 12 Biology Suggestion 2024 FOR TBSE CBSE ICSE Tripura

TBSE Tripura Class 12 Biology Suggestion 2024

This suggestion covers all Boards like TBSE, CBSE and ICSE. We provide free of cost suggestion every year. Visit the website for Arts, Science and Commerce Suggestions. We also provide coaching guidance for the Entrance like NEET, JEE, TBJEE, CUET Law, NFSU and Govt Competitive Job Like TPSC, SSC, IBPS, RRB, UPSC NDA CDS coaching. Class 12 Biology Suggestion will help you to get good marks in the exam.

Reproduction in Organisms 

Class 12 Biology Suggestion 2024 FOR TBSE CBSE ICSE Tripura

TBSE Tripura Class 12 Biology Suggestion 2024 This suggestion covers all Boards like TBSE, CBSE and ICSE. We provide free of cost suggestion every year. Visit the website for Arts, Science and Commerce Suggestions. We also provide coaching guidance for the Entrance like NEET, JEE, TBJEE, CUET Law, NFSU and Govt Competitive Job Like TPSC, SSC, IBPS, RRB, UPSC NDA CDS coaching. Class 12 Biology Suggestion will help you to get good marks in the exam. Reproduction in Organisms  Tripura Class 12 Biology Suggestion 2024 FOR TBSECBSE ICSE     1. Why is reproduction essential for organisms? Ans: Reproduction is the ability of living organisms to produce a young one similar to itself. It ensures continuity of a species generation after generation. Reproduction introduces variation in the organisms. Useful variations are essential for adaptation and evolution. Therefore, it is essential for organisms. 2. Which is a better mode of reproduction sexual or asexual? Why? Ans: Sexual reproduction is a better mode of reproduction because of the following reasons: Variation : Since fusion of gametes from different parents occur during sexual reproduction, hence genetic recombination takes place causing variations. Evolution : Variation being a major factor of natural selection, therefore, it plays an important role in evolution. Adaptation : The offspring produced due to sexual reproduction adapt better to the changing environmental conditions. Vigour and Vitality : Genetic recombination, interaction, etc. during sexual reproduction provide vigour and vitality to the offspring. 3. Why is the offspring formed by asexual reproduction referred to as clone? Ans:  Asexual reproduction is a type of reproduction in which a single individual is capable of producing offspring. These offspring are not only genetically and morphologically similar to one another but also similar to their parent. Clone is the term given to individuals that are genetically and morphologically similar. Thus the offspring produced by asexual reproduction are called clones. 4. Offsprings formed due to sexual reproduction have better chances of survival. Why? Is this statement always true? Ans: The offsprings obtained from sexual reproduction have better chances of survival because the genetic material of such organisms are formed from both the parents. Daughter organisms/offsprings show variation that leads to the evolution of species. This statement is always true. The offspring produced due to sexual reproduction adapt better to the changing environmental conditions. Genetic recombination, interaction, etc. during sexual reproduction provide vigour and vitality to the offspring.  5. How does the progeny formed from asexual reproduction differ from those formed by sexual reproduction? Ans: Production of offspring by a single parent without the formation and fiision of gametes is called asexual reproduction. It involves only mitotic cell division that gives rise the daughter cells which are genetically identical to the parent cell. Sexual reproduction is the production of offspring by two parents, male and female. It involves meiotic cell divisions producing haploid nuclei which on fusion produce offspring that are genetically different from their parents. 6. Distinguish between asexual and sexual reproduction. Why is vegetative reproduction also considered as a type of asexual reproduction?  Ans: The difference between asexual and sexual reproduction are as follows : NCERT Solutions For Class 12 Biology Reproduction in Organisms Textbook Questions Q6 In plants asexual reproduction is called vegetative reproduction because vegetative plant parts like rhizome, runner, sucker, tuber, bulb all are capable of producing off springs These parts give rise to daughter individuals without the involvement of two parents. 7. What is vegetative propagation? Give two suitable examples. Ans: Vegetative propagation is the formation of new plants from vegetative units. In plants, the units of vegetative propagation are runner, rhizome, sucker, tuber, offset, bulb, etc. These are capable of producing new offsprings. These structures are called v vegetative propagules. Modified tuberous roots of sweet potato, tapioca, yam, Dahlia and Tinospora can be propagated vegetatively when planted in soil. Small plants emerging from the buds (called eyes) of the potato tuber, from the rhizomes of banana and ginger are other examples.   8. Define:  (a)Juvenile phase (b)Reproductive phase (c)Senescent phase. Ans: (a)Juvenile phase : All organisms have to reach a certain stage of growth and maturity in their life before they can reproduce sexually. That period of growth is called juvenile phase. However, this phase is known as vegetative phase in plants. This phase is of different durations in different organisms. (b)Reproductive phase: The end of juvenile/ vegetative phase marks the beginning of reproductive phase. During this phase, the organisms produce offspring. In higher plants, this phase can be easily seen when they come to flower but in animals, the juvenile phase is followed by morphological and physiological changes prior to active reproductive behaviour. The reproductive phase is also of variable period in different organisms like some plants, flower throughout the year while others show seasonal flowering. In animals like birds lay eggs seasonally “but when in captivity (as in poultry farms) can be made to lay eggs throughout the year. Placental female mammals, undergo cyclical changes in reproductive organs during this phase. (c) Senescent phase: It begins from the end of the reproductive phase. During this phase of life span, there is progressive deterioration in the body (like slowing of metabolism, etc.). Old age ultimately leads to death. 9. Higher organisms have resorted to sexual reproduction in spite of its complexity. Why? Ans: Higher organisms have resorted to sexual reproduction in spite of its complexity because sexual reproduction results in multiplication and perpetuation of species and also contributes to evolution of species by introducing variation much more faster than asexual reproduction in a particular population. Sexual reproduction enables higher organisms to survive during unfavourable conditions. 10. Explain why meiosis and gametogenesis are always interlinked? Ans: Gametogenesis is the process of formation of two types of haploid gametes (male and female). In gametogenesis, gametes are haploid in number and formed by meiosis so the chromosome number is haploid. Thus gametogenesis is always linked with meiosis. 11. Identify each part in a flowering plant and write whether it is haploid (n) or diploid (2n). (a)Ovary ———————— (b)Anther ———————— (c)Egg ———————— (d)Pollen ———————— (e)Male gamete ———————— (f)Zygote ———————— Ans: (a)2n (b)2n (c)n (d)n (e)n (f)2n 12. Define external fertilization. Mention its disadvantages. Ans: When fusion of the gametes takes place outside the body of the organisms, it is called external fertilization or external syngamy. The external medium like water is required for this form of fertilization. This form, is found in many aquatic animals like fishes, amphibians, majority of algae. In this, parents release eggs and sperms in the surrounding water, then fertilization and development of offspring occur externally. Disadvantages of external fertilization: (i)if occurs only in aquatic medium. (ii)A chance factor is involved requiring synchronous release of gametes nearby and absence of turbulence of water. (iii)There is no protection to young ones. They are vulnerable to a number of predators. 13. Differentiate between a zoospore and a zygote. Ans: The zoospore is flagellated, motile, haploid or diploid spore formed inside a zoosporangium. It is the result of asexual reproduction.  The zygote is always diploid and formed by the fusion of gametes. It is usually non- flagellated and non-motile or motile. It is the net result of sexual reproduction.  14. Differentiate between gametogenesis from embryogenesis. Ans: Differences between gametogenesis and embryogenesis are as follows : NCERT Solutions For Class 12 Biology Reproduction in Organisms Textbook Questions Q14 15. Describe the post-fertilization changes in a flower. Ans: In sexual reproduction, events that occur after the formation of zygote are called post-fertilization events. In flowering plants, the zygote is formed inside the ovule. After fertilization the sepals, petals and stamens of the flower wither and fall off. But the pistil remains attached to the plant. The zygote develops into the embryo and the ovules develop into the seed. The ovary develops into die fruit that develops.a thick wall called pericarp which is protective in – function. After dispersal, seeds germinate under favourable conditions to produce new plants. 16. What is % bisexual flower? Collect five bisexual flowers from your neighbourhood and with the help of your teacher find out their common and scientific names. Ans: Flowers in which male and female sex organs (stamens and carpels) are borne on the same flowers are called bisexual flowers. You can observe following bisexual flowers in your kitchen and colony gardens : (i)Brassica (sarson) – Brassica campestris (ii)Onion – Allium cepa (iii)Garden Pea (Edible pea) – Pisum sativum (iv)Petunia – Petunia hybrida (v)China rose (shoe flower) – Hibiscus rosa- sinensis. 17. Examine a few flowers of any cucurbit plant and try to identify the staminate and pistillate flowers. Do you know any other plant that bears unisexual flowers? Ans: The male or staminate flowers of cucurbits bear bright coloured petals and a prominent group of stamens. Male plants or staminate flowers do not bear fruits. The female or pistillate flowers bear fruits. In a fertilised young pistillate flower very small fruit is visible below petals and sepals. Some unisexual plants are : Papaya, Mulberry and Date-palm.  18. Why are offspring of oviparous animals at a greater risk as compared to offspring of viviparous animals? Ans: On the basis of the development of the zygote, animals are grouped into oviparous and viviparous. The oviparous animals such as reptiles and birds lay eggs. Their fertilised eggs are covered by hard calcareous shell and are laid in a safe place in the environment. After incubation period, young ones hatch out. In viviparous animals such as majority of mammals including human beings, the zygote develops into a young one inside the body of the female individual. After a certain growth period, the young ones are delivered by the female individual. Due to proper care and protection, the chances of survival of young ones are more in viviparous individuals. Oviparous offsprings are at a greater risk than viviparous ones. TBSE Tripura Class 12 History Suggestion 2023      Sexual Reproduction in Flowering Plants   1. Name the parts of anangiosperm flower in which development of male and female gametophytes take place. Ans: Development of male gametophyte (micro- gametogenesis) occurs in pollen sac of anther up to 2 – celled stage. The female gametophyte develops (megagametogenesis) in the nucellus of ovule. 2. Differentiate between microsporogenesis and megasporogenesis. Which type of cell division occurs during these events? Name the structures formed at the end of these two events? Ans: Differences between microsporogenesis and megasporogenesis are as follows – NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q2 Each microspore mother cell and megaspore mother cell contain two sets of chromosomes and are therefore diploid. The diploid megaspore mother cell and microspore mother cell enlarges and undergo meiosis to produce, four haploid cells called megaspores and microspores respectively.The chromosome number is reduced by half and therefore megaspores and microspores are haploid. Microsporogenesis and megasporogenesis give rise to pollen grains and embryo sac respectively. Pollen grain is the male gametophyte and embryo sac represents the female gametophyte. 3. Arrange the following terms in the correct development sequence: Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes. Ans: The correct developmental sequence for the formation of male gametes is : Sporogenous tissue —» Pollen mother cell —» Microspore tetrad —» Pollen grain —» Male gametes.  4. With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.   Ans: NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q4  A typical angiospermic ovule is a small structure which is formed in the ovary. Ovule first develops as a projection on the placenta and composed of multilayered cellular tissue called the nucellus. The hypodermal cell of die nucellus enlarges and transformed into megaspore mother cell. This cell undergoes meiosis to produce four haploid cells only one of which develops & forms embryo sac (female gametophyte). An ovule may be surrounded by one or two protective layers called integuments, leaving a small opening at one end termed as micropyle which acts as passage for the entry of the pollen tube into the ovule. Thus, a typical ovule consists of a fully developed embryo sac with the nucellus and integuments. 5. What is meant by monosporic development of female gametophyte? Ans: In majority of flowering plants one of the megaspores is functional while the other three degenerate. Only the functional megaspore develops into the female gametophyte or embryo sac. This method of development of embryo sac from a single megaspore is called monosporic development.  6. With a neat diagram explain the 7-celled, 8- nucleate nature of the female gametophyte. Ans: NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q6  Embryo sac (or female gametophyte) is formed by three successive mitotic divisions that take place in the nucleus of megaspore. The nucleus of the functional megaspore divides meiotically to form two nuclei which move to the opposite poles, forming the 2-nucleate embryo sac. Two more sequential mitotic nuclear divisions result in the formation of the 4-nucleate and later the 8-nucleate stages of the embryo sac. After the 8-nucleate stage, cell walls are laid down leading to the organisation of the typical female gametophyte or embryo sac. Six of the eight nuclei are grouped together at micropylar and chalazal end and form the egg apparatus and antipodals respectively. The large central cell left over with two polar nuclei. Thus, a typical female gametophyte consists of 7 cells with 8 nucleus.  7. What are chasmogamous flowers? Can cross-pollination occur in deistogamous flowers? Give reasons for your answer.   Ans: Chasmogamous flowers are those flowers which are open with exposed anther and stigma.  Cleistogamous flowers are those flowers which do not open at all. In these flowers, the anthers and stigma lie close to each other, when anthers dehisce in the flower buds, the pollen grains come in the contact with stigma to effect pollination. So these flowers are invariably self-pollinated as the flowers remain closed and there is no chance of cross pollen landing on the stigma. Pollination and seed setting are assured even in the absence of pollinators  8. Mention two strategies evolved to prevent self-pollination in flowers. Ans: Continued self-pollination decreases the vigour and vitality of a particular race. Thus, flowering plants have developed many devices to discourage self-pollination and to encourage cross-pollination. Dichogamy and self-sterility are.two most common devices that ensure cross-pollination. Dichogamy – Maturation of anther and stigma at different times in a bisexual flower prevent self-pollination. Self-sterility (or self-incompatibility) – Due to the presence of self-sterile gene in some flowers, pollen grains do not germinate on the stigma of that flowers. e.g.,- tobacco, potato.  9. What is self-incompatiblility? Why does self-pollination not lead to seed formation in self-incompatible species? Ans: If a pistil carrying functional female gametes fails to set seeds following pollination with viable and fertile pollen, capable of bringing about fertilisation in another pistil, the two are said to be incompatible, and the phenomenon is known as sexual incompatibility. Sexual incompatibility may be interspecific (between individuals of different species) or intraspecific (between individuals of the same species). The latter is also called self-incompatibility. Self-incompatibility is a gene-physiological process. Incompatibility reactions are controlled by a single gene, called S-gene, which has several alleles. Pollen grains that possess the S-allele common to any one of the two alleles present in the cells of the pistil, will not be functional on that particular pistil. However, every pollen grain having no common S alleles with pistil would be functional on the pistil of a that plant. As self pollens are unable to fertilise the egg to form pmbryo, hence seeds are not formed in self-incompatible species.  10. What is bagging technique? How is it useful in a plant breeding programme? Ans: It is the covering of emasculated flowers (removal of anthers in bud condition from a bisexual flower by a bag of butter paper or polythene in their bud condition i.e., before anthesis) to prevent contamination of its stigmas with unwanted pollens. When the stigmas of emasculated flowers mature the bags are removed, stigmas are dusted with pollen grains of desired male . plants by means of a presterilized brush and flowers are rebagged till fruit develop. This technique is mainly used in artificial hybridization. Plant breeders often use this technique to prevent the contamination of stigma of the flowers from unwanted pollen grains.   11. What b triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.    Ans: Fusion of second male gamete with die two polar nuclei located in the central cell to form the triploid primary endosperm nucleus (PEN) is called triple fusion or vegetative fertilization. This process takes place in the embryo sac. After reaching the ovary, pollen tube enters into the embryo sac from the micropylar end. After penetration, the tip of the pollen tube ruptures releasing the two male gametes. The one male gamete fuses with the egg to form the diploid zygote. This process is called syngamy and the other male gamete fuses with the two polar nuclei to form the triploid primary endosperm & this process is known as triple fusion. These two events of fertilization constitute the process of double fertilization. 12.Why do you think the zygote is dormant for sometime in a fertiUsed ovule? Ans: The zygote after a period of rest develops into embryo. Most zygotes remain dormant till certain amount of endosperm forms. They do so, to provide assured nutrition to the developing embryo.  13. Differentiate between: (a)hy pocotyl and epicotyl; (b)coleoptile and coleorrhiza; (c)integument and testa; (d)perisperm and pericarp. Ans: NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q13   NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q13.1  14. Why is apple called a false fruit? Which Part(s) of the flower forms the fruit? Ans: Botanically ripened ovary is called a true fruit. The fruits in which thalamus and other floral parts develop along with the ovary are called false fruits. For example – apple, strawberry, cashew etc. In apple the main edible portion of the fruit is the fleshy thalamus. Ovary forms the fruit after fertilization or without fertilization in parthenocarpic fruits. 15. What is meant by emasculation? When and why does a plant breeder employ this technique? Ans: Removal of stamens or anthers of a bisexual flower without affecting the female reproductive organs is called emasculation. This technique is used in artificial hybridisation. In such crossing experiments it is important to make sure that only the desired pollen grains are used for pollination and the stigma is protected from contamination from unwanted pollens. This is achieved by emasculation and bagging technique. This technique is used to obtain desired variety of seeds.  16. If one can induce parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?  Ans: Parthenocarpic fruits are seedless. They develop from ovary without fertilization. Banana, grapes, oranges, Pineapple, Guava, Watermelon, lemon are selected because these seedless of units are of high economic importance. The fruits in which seeds or seed part form edible portion (e.g.,Pomegranate) are not selected to induce parthenocarpy.  17. Explain the role of tapetum in the formation of pollen grain wall.  Ans: Tapetum is the innermost wall layer of anther. The cells of this layer have large nuclei and dense cytoplasm. This layer is of great physiological importance as most of the food material from outside passes through this layer. At maturity, these cells degenerate and provide nourishment to developing microspores or pollens inside. Tapetum is the layer, which secretes both enzymes and substances of hormonal nature. The main function of tapetum is to provide nutrition to pollens but it also secretes some substances of utmost importance like : Qallase enzyme : Tapetum secretes callase enzyme which dissolves callose substances by which four pollens of a pollen tetrad are united, hence separating microspores or pollens of a tetrad. Ubisch bodies : These bodies of lipid nature are also secreted by tapetum. Ubisch bodies get covered with sporopollenin and thus increase thickness of exine (i.e., outer layer of pollen wall). Ubisch bodies are spheroidal and have diameter of only few microns. These are produced only by glandular tapetum (not by amoeboid tapetum). Pollen kit substances : Tapetum also secretes pollen kit, outer most oily, thick, viscous, sticky, electron dense homogeneous coating of pollen grains of many entomophilous plants. 18. What is apomixis and what is its importance?  Ans: Apomixis is a mode of asexual reproduction that produces seeds without fertilization, e.g.- some species of Asteraceae and Grasses. This method is important in hybrid seed industry. Hybrids are extensively cultivated for increasing productivity. But the main drawback is that the hybrid seeds are to be produce every year because the seeds of the hybrid plants da not maintain hybrid characters for longer period due to segregation of characters. This can be avoided if apomixis can be introduced in hybrid seeds. For this reason scientists are trying hard to identify genes for apomixis. Human Reproduction  1. Fill in the blanks: (a)Humans reproduce————— (asexually/sexually). (b)Humans are————— (oviparous, viviparous,ovoviviparous). (c)Fertilization is————— in humans (external/internal). (d)Male and female gametes are—————(diploid/haploid). (e)Zygote is————— (diploid/haploid). (f)The process of release of ovum from a mature follicle is called————— . (g)Ovulation is induced by a hormone called————— (h)The fusion of male and female gametes is called————— . (i)Fertilization takes place in————— (j)Zygote divides to form————— which is implanted in uterus. (k)The structure which provides vascular connection between foetus and uterus is called————— . Ans: (a) sexually (b) viviparous (c) internal (d)haploid (e)diploid (f)ovulation (g)LH (Luteinizing hormone) (h)fertilization (i)ampullary-isthmic junction (fallopian tube) (j)blastocyst (k)placenta (Umbilical cord)  2. Draw a labelled diagram of male reproductive system.  Ans: NCERT Solutions For Class 12 Biology Human Reproduction Q2 3. Draw a labelled diagram of female reproductive system. Ans: NCERT Solutions For Class 12 Biology Human Reproduction 1 NCERT Solutions For Class 12 Biology Human Reproduction 2 4. Write two major functions each of testis and ovary.  Ans: Testes are components of both the reproductive system (being gonads) and the endocrine system (being endocrine glands). The respective functions of the testes are – producing sperm (spermatozoa) by the process of spermatogenesis and producing male sex hormones, of which testosterone is the best-known. Testosterone stimulates development of testes and of male secondary sexual characteristics. The ovaries have two major functions. One is the production of eggs or ova, and the second is the production of hormones or chemicals which regulate menstruation and other aspects of health and well-being, including sexual well-being. Estrogen and progesterone are the most important hormones which serve many functions like, they induce and maintain the physical changes during puberty and the secondary sex characteristics and they support maturation of the uterine endometrium in preparation for implantation for a fertilised egg, etc.  5. Describe the structure of a seminiferous tubule.  Ans: The seminiferous tubule is a structural unit in the adult testis. The seminiferous tubules are situated in testicular lobules. Seminiferous tubule consists of two types of cells – Sertoli or supporting cells & spermatogenic cellsl Sertoli cells, are elongated and pyramidal & partially envelop the spermatogenic cells. The cells provide nourishment to the developing spermatogenic cells. Spermatogenic cells are stacked in 4-8 layers. These cells divide several times & differentiate to produce spermatozoa. Between seminiferous tubules lie the interstitial cells or leydig cells which produces testosterone hormone.  6. What is spermatogenesis? Briefly describe the process of spermatogenesis.  Ans: Spermatogenesis is the process of producing sperms with half the number of chromosomes (haploid) as somatic cells. It occurs in seminiferous tubules. Sperm production begins at puberty continues throughout life with several hundred million sperms be ing produced each day. Once sperm are formed they move into the epididymis, where they mature and are stored. During spermatogenesis one spermatogonium produces 4 sperms. Spermatogenesis completes through the following phases – multiplicative phase, growth phase, maturation phase & spermiogenesis. In multiplicative phase the sperm mother cells divide by mitosis & produce spermatogonia. The spermatogonia grow in size to form large primary spermatocytes by getting nourishment from sertoli cells in growth phase. Maturation phase involves meiosis I in which primary spermatocytes divide to produce secondary spermatocyte and meiosis II which produces spermatids. Thus each primary spermatocyte gives rise to four haploid spermatids. Spermiogenesis or spermateliosis is process of formation of flagellated spermatozoa from spermatids. Spermiogenesis begins in the seminiferous tubules but usually completed in epididymis. NCERT Solutions For Class 12 Biology Human Reproduction Q6 7. Name the hormones involved in regulation of spermatogenesis.  Ans: The hormones involved in regulation of spermatogenesis are GnRH, LH, FSH and androgens. Spermatogenesis starts at the age of puberty due to significant increase in the secretion of gonadotropin releasing hormone (GnRH). The increased levels of GnRH then acts at the anterior pituitary gland and stimulates secretion of two gonadotropins – luteinising hormone (LH) and follicle stimulating hormone (FSH). LH acts at the Leydig cells and stimulates synthesis and secretion of androgens. Androgens, in turn, stimulate the process of spermatogenesis. FSH acts on the Sertoli cells and stimulates secretion of some factors which help in the process of spermiogenesis.  8. Define spermiogenesis and spermiation. Ans: Spermiogenesis is the process of transformation of spermatids into mature flagellated spermatozoa (sperms).Spermiation is the process of release of mature spermatozoa. In this spermatozoa are shed into the lumen of seminiferous tubule for transport. 9. Draw a labelled diagram of sperm. Ans: NCERT Solutions For Class 12 Biology Human Reproduction Q9 10.What are the major components of seminal plasma? Ans: Seminal plasma is the fluid in which sperm is ejaculated. Major components of seminal plasma are secretions from seminal vesicles, prostrate and bulbourethral gland and sperms from testis. It is rich in fructose and contains enzymes, citric acid, hormones like prostaglandins, calcium and clotting proteins. 11. What are the major functions of male accessory ducts and glands? Ans: Male accessory ducts include rete testis, vasa efferentia, epididymis and vas deferens. These ducts store and transport sperms from the testis to the outside through urethra. The male accessory glands include paired seminal vesicles, a prostate and paired bulbourethral glands. Secretions of these glands constitute the seminal plasma which is rich in fructose, calcium and certain enzymes. The secretions of bulbourethral glands also helps in the lubrication of the penis. 12. What is oogenesis? Give a brief account of oogenesis. Ans: The process of formation of a mature female gamete (ovum) is called oogenesis. It occurs in the ovaries of female reproductive system. Oogenesis is a discontinuous process it begins before birth, stops in midprocess & only resumes after menarch. It occurs in three phases : Multiplicative phase (formation of oogonia mitotically from the primary germ cells), Growth phase (growth of oogonia into primary oocyte) & Maturation phase (formation of mature ova from primary oocyte through meiosis). Maturation phase produces two haploid cells – Larger one called secondary oocyte & the smaller one called polar bodies (1st polar body). Meiosis II of secondary oocyte results in the formation of functional egg or ovum and a second polar body: The first polar body may also divide to form two polar bodies of equal sizes which do not take part in reproduction & ultimately degenerates. First maturation division may be completed in the ovaries just prior to ovulation but second one (Final) is completed outside the ovary after fertilization. Secondary oocyte is female gamete in which the 1st meiotic division is completed & second meiotic division (Metaphase stage) has begin. The egg is released at secondary oocyte stage under the effect of LH. NCERT Solutions For Class 12 Biology Human Reproduction Q12 13. Draw a labelled diagram of a section through ovary.  Ans: NCERT Solutions For Class 12 Biology Human Reproduction Q13 14. Draw a labelled diagram of a Graafian follicle. Ans: NCERT Solutions For Class 12 Biology Human Reproduction Q14 15. Name the functions of the following:  (a) Corpus luteum (b) Endometrium (c) Acrosome (d) Sperm tail (e) Fimbriae Ans: (a) Corpus luteum : The corpus luteum secretes large amounts of progesterone which is essential for maintenance of the endometriuip. (b) Endometrium is necessary for implantation of the fertilized ovum and other events of pregnancy. (c) The acrosome is filled with enzymes that help during fertilization of the ovum. (d) Sperm tail: Tail facilitates sperm motility which is essential for fertilization. (e) Fimbriae: Fimbriae help in collection of the ovum after ovulation. 16. Identify True/False statements. Correct each false statement to make it true. (a) Androgens are produced by Sertoli cells. (True/False) (b) Spermatozoa get nutrition from sertoli cells. (True/False) (c) Leydig cells are found in ovary. (True/ False) (d) Leydig cells synthesize androgens. (True/ False) (e) Oogenesis takes place in corpus luteum. (True/False) (i) Menstrual cycle ceases during pregnancy. (True/False) (g) Presence or absence of hymen is not a reliable indicator of virginity or sexual – experience. (True/False) Ans: (a) False, Androgens or male sex hormones (e.g, testosterone) are secreted by Leydig cells. (b) True. (c) False, Leydig cells are found in testis. (d) True. (e) False, Oogenesis takes place in ovary. (f) True. (g) True. 17. What is menstrual cycle? Which hormones regulate menstrual cycle?  Ans: Menstrual cycle is the cyclic change( itf’the reproductive tract of primate female. This period is marked by a characteristic event repeated almost every month (28 days with minor variation) in the form of a menstrual flow (i.e. shedding of the endometrium of the uterus with bleeding. It may be temporarily stopped only in pregnancy. The hormones that regulates menstrual cycles are (i) FSH (Follicle stimulating hormone), (ii) LH (Luteinizing hormone), (iii) Oestrogens, (iv) Progesterone. 18. What is parturition ? Which hormones are involved in induction of parturition?  Solution: Parturition (or labour) means child birth. Parturition is the sequence of actions by which a baby and the afterbirth (placenta) are expelled from the uterus at childbirth. The process usually starts spontaneously about 280 days after conception, but it may be started by artificial means. The process of parturition is induced by a complex neuroendocrine mechanisms involving cortisol, estrogen and oxytocin.  19. In our society the women are often blamed for giving birth to daughters. Can you explain why this is not correct? Ans: The sex chromosome pattern in the human females is XX and that of male is XY. Therefore, all the haploid female gametes (ova) have the sex chromosome X, however, the haploid male gametes have either X or Y. Thus 50% of sperms carry the X-chromosome while the other 50% carry the Y-chromosome. After fusion of the male and female gametes, the zygote carries either XX or XY depending upon whether the sperm carrying X or Y fertilizes the ovum. The zygote carrying XX would be a female baby and XY would be a male baby. That is why it is correct to say that the sex of the baby is determined by the father. 20. How many eggs are released by a human ovary in a month? How many eggs do you think would have been released if the mother gave birth to identical twins? Would your answer change if the twins born were fraternal?  Ans: One egg is released by human ovary in a month. Identical twins: Identical twins are formed when a single fertilized egg splits into two genetically identical parts. The twins share the same DNA set, thus they may share many similar attributes. However, since physical appearance is influenced by environmental factors and not just genetics, identical twins can actually look very different. Fraternal twins: These twins are formed when two fertilized eggs are formed. The twins share the different DNA set, thus they may share different attributes (dizygotic embryo). 21. How many eggs do you think were released by the ovary of a female dog which gave birth to 6 puppies? Ans: Since dogs have multiple births, several eggs mature and are released at the same time. If fertilised, the egg will implant on the uterine wall. Dogs bear their litters roughly 9 weeks after fertilisation, although the length of gestation can vary from 56 to 72 days. An average litter consists of about six puppies, though this number may vary widely based on the breed of dog. On this basis 6 eggs were released by the ovary of a female dog which gave birth to 6 puppies.  Reproductive Health  1. What do you think is the significance of reproductive health in a society? Ans: Reproductive health in a society is significant because the people are aware of (i) birth control methods and advantages of small family, (ii) sexually transmitted diseases and methods to avoid them, (iii) importance breast feeding and post natal care of the mother and baby and (iv) equal opportunities for the male and female children. 2. Suggest the aspects of reproductive health which need to be given special attention in the present scenario. Ans: The aspects of reproductive health which need to be given special attention are : Introduction of sex education in schools to give right information to the young minds about reproductive organs, accessory organs of reproduction, secondary sexual characters, adolescence and related changes, safe and hygienic sexual practices, STDs etc. Providing knowledge about available birth control methods, care of pregnant mothers, post-natal care of the mother and child, importance of breast feeding etc. Creating awareness about consequences of uncontrolled population growth and social evils (sex abuses and sex-related crimes, use of drugs, tobacco and alcohol etc.) among young people. 3. Is sex education necessary in schools? Why? Ans: Yes, sex education is necessary in school. Because introduction of sex education in school encourage to provide the right or correct information to the young peoples so as to discourage children from believing in myths & having misconceptions about sex related aspects. Proper information about reproductive organs, safe & hygienic sexual practices, STD’s etc. would help people, those in the adolescent age group to lead a healthy reproductive life. In many countries, sexual education raises much contentious debate. Chief among the controversial points is whether covering child sexuality is valuable or detrimental; the use of birth control such as condoms and hormonal contraception, and the impact of such use on pregnancy, outside marriage, teenage pregnancy, and the transmission of STDs. Increasing support for abstinence – only sex education by conservative groups has been one of the primary causes of the controversies. 4. Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement  Ans: Yes, in the last 50 years, reproductive health in our country has improved. Some such areas of improvement are (i) massive child immunization (ii) maternity and child health (iii) increasing use of contraceptives (iv) family planning. Bringing sexual and reproductive health services to the millions of people living in countries which still suffer from short life expectancies, high levels of child and maternal mortality, child lSS&ur and illiteracy and poor overall health remains a major challenge for governments and non government organizations.  5. What are the suggested reasons for population explosion? Ans: (i) Increased health facilities along with better living conditions had an explosive impact on the growth of population. (ii) Decline in Death rate (iii) Decline in Maternal Mortality Rate (iv) Decline in Infant Mortality Rate (v) Increase in the number of people in the reproductive age. 6. Is the use of contraceptives justified ? Give reasons. Ans: Population in India is increasing at a very fast rate and such a growth necessitated intense use of contraceptive methods to bring all the fertile couples under its cover. It will help in bringing the birth rate down and consequently check the population growth. Therefore, the use of contraceptives is justified. It is essential to mention here that the selection of a suitable contraceptive method should be practiced in consultation with qualified doctors. The government provides these facilities free at the family planning centres. Contraceptives are given free or at nominal prices at these centres to the couples of reproductive age desirous of preventing conception.  7. Removal of gonads cannot be considered as a contraceptive option. Why?  Ans: Removal of gonads or its parts is a surgical method, of sterilization. Vasectomy and tubectomy are carried out in males and females respectively. It will lead to infertility & both male and female will be dependent on hormones in their remaining life to regulate functioning of reproductive organs. These are very effective but their irreversibility is very poor, so they are not good options for contraception.  8. Amniocentesis for sex determination is banned? in our country. Is this ban necessary? Comment Ans: Since Amniocentesis is misused to find out the sex of the foetus leading to female foeticides, it is necessary. It is the prenatal diagnostic technique, that helps to find out chromosomal (genetic) disorders, metabolic disorders of the foetus; in extreme cases where the foetus is found to be suffering from an incurable disorder Medical Termination of Pregnancy (MTP) is banned. The solution to the problem is not ‘ passing more laws, such as banning sex determination ultrasounds but raising the social & economic status of women, 9. Suggest some methods to assist infertile couples to have children. Ans: ART (Assisted Reproductive Technologies) is a term that describes several different methods used to help infertile couples. ART involves removing eggs from a woman’s body, mixing them with sperm in the laboratory and putting the embryos bath into a woman’s body. Success rates vary depending on many factors.Something that affects the success rate of ART includes age of the partners, reason for infertility,type of ART, if the egg is fresh or frozen. Various methods are now available to help such couples are — in vitro fertilization, gamete intra fallopian transfer, intracytoplasmic sperm injection & artificial insemination. (i) In vitro fertilization – Patient’s egg & her partner’s sperm are collected & mixed together in a laboratory to achieve fertilization outside the body. The embryo produced may then be transferred into the female patient. It is commonly knownas test tube baby programme. (ii) Gamete Intra Fallopian Transfer (GIFT) – A procedure in which eggs are retrieved from a woman, mixed with sperm & immediately replaced in one or other of the women’s fallopian tubes so that they fertilize inside the body (invivo). (iii) Intra Cytoplasmic Sperm Injection (ICSI)– In this method, sperm & eggs are retrieved from both the parents. A single sperm is injected directly into an egg, then the fertilized egg is implanted into the woman’s uterus. (iv)Artificial insemination – In this technique, the semen is collected either from husband or a healthy donor & is artificially introduced either into the vagina or into the uterus of the female (IUI-Intra uterine insemination).  10. What are the measures one has to take to prevent from contracting STDs? Ans: (i) Avoiding sex with unknown partner /multiple partners. (ii) Always use condoms during intercourse. (iii) In case of doubt, go for medical professional for early detection and get complete treatment if diagnosed with disease. (iv) Education & counselling of persons at risk on ways to adopt safer sexual behaviour. 11. State True/False with explanation (a) Abortions could happen spontaneously too. (True/False) (b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False) (c) Complete lactation could help as a natural method of contraception. (True/False) (d) Creating awareness about sex related aspects is an effective method to improve reproductive health of the people. (True/False) ''  Ans: (a) True. Due to internal factors like incompatibility, abortion could happen spontaneously. (b)False. It is due to abnormalities/defects in either male or female or both the partners. (c)True, but it is limited to period up to six months after parturition. (d)True. Creating awareness about sex-related aspects removes the myths and miconcep- tions about these problems. 12. Correct the following statements: (a) Surgical methods of contraception prevent gamete formation. (b )Ail sexually transmitted diseases are completely curable. (c) Oral pills are very popular contraceptives, among the rural women. (d) In E.T. techniques, embryos are always transferred into the uterus. Ans: (a) Surgical methods of contraception prevent gamete transport & thereby prevent conception. (b) Except for hepatitis-B, genital herpes, and HIV infections, other STD diseases are completely curable if detected early and treated properly. (c) Oral pill are very popular contraceptives among the educated urban women. (d) In E.T. techniques, embryos with 8 blastomeres are transferred into fallopian tube and more than 8 blastomeres are transferred into the uterus.  Principles of Inheritance and Variation 1.Mention the advantages of selecting pea plant for experiment by Mendel Ans: Mendel select garden pea (Pisum Sativum) for the following reasons. (i) It is an annual plant with short life span and gives results within 3 months. (ii) The plant is grown easily and does not require after care except at the time of pollination. (iii) F1 hybrids are fertile. (iv) Seven pairs of contrasting characters easily detectable. (v) True breeding self pollination.  2. Differentiate between the following –   (a) Dominance and Recessive (b) Homozygous and Heterozygous (c) Monohybrid and Dihybrid. Ans: (a)The difference between dominance and recessive me: NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q2 (b) Differences between homozygous and heterozygous individuals : NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q2.1 (c) In breeding experiments when a cross is made between the individuals considering their same single character, it is called mono¬hybrid cross, while a cross is done consid¬ering two characters at fee same time is called dihybrid cross (Yellow Round * Green Wrinkled).  3. A diploid organism is heterozygous for 4 loci, how many types of gametes can be produced?     Ans: For a diploid organism, which is heterozygous for 4 loci, then 24 i.e. 2 x 2 x 2 x 2 = 16 types of gametes can be produced if the genes are not linked because for each heterozygous pair of genes there are two possibilities. So, for 4 pair the number of combination will be 16 gametes.  4. Explain the Law of Dominance using a monohybrid cross. Ans: When two different factors (genes) or a pair of contrasting forms of a character are present in an organism, only one expresses itself in the F, generation and is termed as dominant while the other remains unexpressed and called recessive factors (gene). A tall (TT) true breeding plant is crossed with a dwarf (tt) plant. The character of height is represented by‘T’ for tall‘t’ for dwarf are the alternate form as character of height. The Fj hybrid ‘Tt’ is Tall, showing that tall is dominant over dwarf while dwarf remains unexpressed in F, offspring due to phenomenon of dominance by tall factor or gene.In this Tt heterozygous has tall phenotype showing T is dominant over t allele. NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q4  5. Define and design a test-cross. Ans: When an individual is crossed with the homozygous recessive parent. It is called test cross. NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q5 Test cross helps in establishing hetero/ homozygosity of dominant trait.  6. Using a Punnett Square, workout the distribution of phenotypic features in the first filial generation after a cross between a homozygous female and a heterozygous male for single locus.     Ans: NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q6 Phenotype: All tall Genotype ratio : TT: Tt 2:2 or 1:1  7. When a cross is made between tall plant with yellow seeds (TtYy) and tall plant with green seed (Ttyy), what proportions of phenotype in the offspring could be expected to be (a)tali and green. (b)dwarf and green. Ans: A cross between tall plant with yellow seeds (TtYy) & tall plant with green seed (Ttyy) is given below. NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q7  8. Two heterozygous parents are crossed. If the two loci are linked what would be the distribution of phenotypic features in F1 generation for a dihybrid cross?     Ans: Consider 2 characters Blue (B), long (L) seeds of a plant – both characters linked. NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q8  9. Briefly mention the contribution of T.H. Morgan in genetics. Ans: Thomas Hunt Morgan (1866-1945), an American geneticist and Nobel Prize winner of 1933, is considered as “Father of experimental genetics” for his work on and discovery of linkage, crossing over, sex linkage, criss cross inheritance, linkage maps, mutability of genes, etc. He is called fly man of genetics because of selecting fruit fly (Drosophila melanogaster) as research, material in experimental genetics. It was largely due to his book, “The Theory of Gene”, that genetics was accepted as a distinct branch of biology. In 1910, he discovered linkage and distinguished linked and unlinked genes. Morgan and Castle (1911) proposed “Chromosome Theory of Linkage” showing that genes are located on the chromosomes and arranged in linear order. Morgan and Sturtevant (1911) found that frequency of crossing over (recombination) between two linked genes is directly proportional to the distance between the two. 1% recombination is considered to be equal to 1 centi Morgan (cM) or 1 map unit. He worked on sex linked inheritance and reported a white eyed male Drosophila in a population of red eyed and proved that gene of eye colour is located on X-chromosome. The male passed its genes on X-chromosomes to the daughter while the son gets genes on X-chromosome from the female (mother): It is called criss-cross inheritance.  10. What is pedigree analysis? Suggest how such an analysis, can be useful.       Ans: Pedigree analysis is study of pedigree for the transmission of particular trait and finding the possibility of absence or presence of that trait in homozygous or heterozygous state in a particular individual. Pedigree analysis helps- (i) in analysis of transmission of character in family over generation. (ii) in genetic counselling of disease like haemophilia. (iii) to identify whether a particular genetic disease is due to recessive gene or a dominant gene. (iv) to identify the possible origin of the defective gene in the family or in a population.  11. How is sex determined in human beings? Ans: Sex determination refers to the mechanisms employed by organisms to produce offsprings that are of two different sexes. The sex of an individual is determined by the genetic information present in the individual’s sex chromosomes. Sex determination in human is done by XY type chromosome. In humans, females have two XX chromosomes and males have two different chromosomes (XY).  12. A child has blood group O. If the father has blood group A and mother of blood group B, work out the genotypes of the parents and the possible genotypes of the other off springs.     Ans: NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q12  13. Explain the following terms with example (a) Co-dominance (b) Incomplete dominance Ans: (a) Codominance : Codominance is the phenomenon of two contrasting alleles of the same gene lacking dominant recessive ratio and expressing themselves simultaneously when present together. E.g. ABO blood group system – Human blood group AB is formed when alleles of blood groups A and B are present together (IAIB). Such RBCs carry both antigen A & B showing that both die alleles are expressing their effect phenotypically & codominant. (b) Incomplete dominance : Incomplete dominance may be defined as the partial /expression of both alleles in a heterozygote so that the phenotype is intermediate between those of two homozygotes. In this none of the allele is completely dominant, e.g., Pink colour flower in dog flower. In Mirabilis jalapa & Snapdragon or dog flowers, there are two types of flower colour in pure state-red & white. When the two types of plant are crossed, the hybrid or plants of Fj generation have pink flowers. The pink colour apparently appears either due to mixing of red & white colours (incomplete dominance) or expression of a single gene for pigmented flower which produces only pink colour.  14. What is point mutation? Give one example.     Ans: Mutations arising due to change in single base pair of DNA is called point mutation. Eg., sickle cell anaemia, haemophilia.  15. Who had proposed the chromosomal theory of the inheritance? Ans: Chromosomal theory of inheritance was proposed by Sutton and Boveri independently in 1902. The two workers found a close similarity between the transmission of Mendelian hereditary factors (genes) and behaviour of chromosomes during gamete formation and fertilisation. They proposed that chromosomes were the carriers of the Mendelian factors. It is the chromosome and not genes which segregate and assort independently during meiosis and recombine at the time of fertilisation in the zygote. Chromosomal theory of inheritance was expanded by Morgan, Sturtevant and Bridges.  16. Mention any two autosomal genetic disorders with their symptoms. Ans: Sickle cell anaemia : Haemoglobin has less 02 transport, sickle shaped RBCs etc. Phenylketonuria : Mental retardation (due to accumulation of phenylalanine in brain), hypopigmentation of skin & hair, eczema etc.  Molecular Basis of Inheritance 1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine. Ans: Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.  2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA. Ans: In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.  3. If the sequence of one strand of DNA is written as follows: 5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′ Write down the sequence of complementary strand in 5′ —> 3′ direction. Ans: If the sequence of one strand of DNA is written as follows: 5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′ The sequence of the complementary strand in 5′ —> 3′ direction will be: 5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′  4. If the sequence of the coding strand in a transcription unit is written as follows: 5-ATGCATGCATGCATGCATGCA TGCATGC-3′     Write down the sequence of mRNA. Ans: mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.  5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain Ans: The antiparallel, double-stranded nature of the DNA molecule led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They suggested that the two strands of DNA molecule uncoil and separate, and each strand serves as a template for the synthesis of a new (complementary) strand alongside it. The template and its complement, then form a new DNA double strand, identical to the original DNA molecule. The sequence of bases which should be present in the new strands can be easily predicted because these would be complementary to the bases present in the old strands. A will pair with T, T with A, C with G, and G with C. Thus, two daughter DNA molecules identical to the parent molecule are formed and each daughter DNA molecule consists of one old (parent) strand and one new strand. Since only one parent strand is conserved in each daughter molecule, this mode of replication is said to be semiconservative. Meselson and Stahl and Joseph Taylor, later proved it by experiments.  6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases. Ans: (i) DNA dependent DNA polymerase – synthesis. (ii) DNA dependent RNA polymerase – synthesis. (iii) RNA dependent DNA polymerase – Retroviral nucleic acid. (iv) RNA dependent RNA polymerase – cDNA synthesis.  7. How did Hershey and Chase differentiate between DNA and protein in their experiment white proving that DNA is the genetic material?     Ans: Alfred Hershey and Martha Chase (1952) worked with viruses that infect bacteria called bacteriophages. In 1952, they chose a bacteriophage known as T2 for their experimental material. They grew some viruses on a medium that contained radioactive phosphorus (p32) and some others on medium that contained radioactive sulphur (s35). Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protem does not. Similarly, viruses grown on radioactive sulphur contained radioactive protein but not radio’active DNA because DNA does not contain sulphur. Radioactive phages were allowed to attach to E. coli bacteria. Then, as the infection proceeded, the viral coats were removed from the bacteria by agitating them in a blender. The virus particles were separated from the bacteria by spinning them in a centrifuge. , Bacteria which was infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This indicates that proteins did not enter the bacteria from the viruses. DNA is therefore the genetic material that is passed from virus to bacteria.  8. Differentiate between the followings: (a) Repetitive DNA and Satellite DNA (b) mRNAand tRNA (c) Template strand and Coding strand Ans: (a) The main differences between repetitive DNA and satellite DNA are as following: (b) The main difference between mRNA and tRNA are as following: (c) The main difference between template strand and coding strand are as follows :  9. List two essential roles of ribosome during translation. Ans: Two essential roles of ribiosomes during translation are ;o (i) they provide surface for binding of mRNA in the groove of smaller sub unit of ribosome. (ii) As larger sub unit of ribosome has peptidy transferase on its ‘P’ site, therefore, it helps in joining amino acids by forming peptide bonds. .  10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then why does lac operon shut down some time after addition of lactose in the medium?       Ans: Lac operon is switched on, on adding lactose in medium, as lactose acts as inducer and makes repressor inactive by binding with it. When the lac operon system is switched on, β-galactosidase is formed, which converts lactose into glucose and galactose. As soon as all the lactose is consumed, repressor again becomes active and causes the system to switch off (shut down).  11. Explain (in one or two lines) the function of the followings: (a) Promoter (b) tRNA (c) Exons Ans: Promoter: It is one of the three components of a transcription unit that takes part in transcription. It is located at the start 5′ end and provides site for attachment of transcription factors (TATA Box) and RNA polymerase. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome for their taking part in protein formation. Exons: In eukarytoes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are transcribed and translated both.  12. Why is the Human genome project called a mega project? Ans: Human genome project is called a mega project because (i) it required bioinformatics data basing and other high speed computational devices for analysis, storage and retrieval of information. (ii) it generated lot of information in the form of sequence annotation. (iii) it was carried out in number of labs and coordinated on extensive scale.  13. What is DNA fingerprinting? Mention its application.     Ans: DNA fingerprinting or DNA typing is a technique of determining nucleotide sequences of certain areas (VNTRs) of DNA which are unique to each individual. Each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue and organ of a person. It cannot be changed by any known treatment. Applications of DNA fingerprinting are as follows:  Paternity disputes can be solved by DNA fingerprinting. DNA fingerprinting technique is being used to identify genes connected with hereditary diseases. It is useful in detection of crime and legal pursuits. It can identify racial groups, their origin, historical migrations and invasions. 14. Briefly describe the following: (a) Transcription (b) Polymorphism (c) Translation (d) Bioinformatics Ans: Transcription : It is DNA directed synthesis of RNA in which the RNA is transcribed on 3*—>5’ template strand of DNA in 5’—>3’ direction. Polymorphism: Variation at genetic level arisen due,to mutation, is called polymorphism. Such variations are unique at particular site of DNA, forming satellite DNA. The polymorphism in DNA sequences is the basis of genetic mapping and DNA finger printing. Translation : Protein synthesis from mRNA, tRNA, rRNA. Bioinformatics : Computational method of handling and analyzing biological databases.   Evolution Evolution Chapter Class 12 NCERT  Q1. Explain antibiotic, resistance observed in bacteria in light of Darwinian selection theory.     Ans: According to Darwin, environment selects organisms with favourable variations and these organisms are allowed to survive. When a bacterial population encounters a particular antibiotic, those sensitive to it die. But some bacteria having mutations become resistant to the antibiotic. Such resistant bacteria survive and multiply quickly as the competing bacteria have died. Some the resistance providing genes become widespread and entire bacterial population becomes resistant.  Evolution Class 12 NCERT Solutions Q2. Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution Ans: New fossil discoveries are as follows :  1. An international research team has recently discovered some amber fly specimens in El Sopalo cave (Cantabria, Spain). According to an article published in the scientific journal ‘Current Biology’, these specimens fed on nector and pollinated gymnosperm plants 105 million years ago.  2. Research conducted in Japan has revealed a very unusual new species of octocoral from a shallow coral reef in Okinawa, Japan. This new species can be considered as “living fossil,” and is related in many ways to the unusual blue coral.  3. The 48 million year old fossil, recovered from the Bridger Formation in Wyoming, is the first description of a new species, named Babibasiliscusalxiby the author, and may represent the earliest clear member of the lizard group, Corytophanidae.  4. Neanderthals became extinct about 40,000 years ago but contributed on average one to three percent to the genomes of present day Eurasians. Researchers have now analysed DNA from a 37,000 to 42,000 year old human mandible in Romania and have found that six to nine percent of this person’s genome came from Neanderthals, more than any other human sequenced till date. Because large segments of this individual’s chromosomes are of Neanderthal origin, a Neanderthal was among his ancestors as recently as four to six generations back in his family tree. This shows that some of the first modern humans that came to Europe mixed with the local Neanderthals.  Chapter 7 Biology Class 12 NCERT Solutions Q3. Attempt giving a clear definition of the term species.   Ans: Species is population or group of individuals that have potential of interbreeding and are able to produce viable, fertile young ones but are reproductively isolated from members of other species.  Evolution NCERT Solutions  Q4. Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.) Ans: NCERT Solutions For Class 12 Biology Evolution Q4 Dietary preference: Dryopithecus and Ramapithecus — herbivores Australopithecus Africans, Homo Carnivores habilis Homo erectus, Homo sapinens — Omnivores  Evolution NCERT Solutions Class 12  Q5. Find out through internet and popular science articles whether animals other than man has self-consciousness. Ans: Recent studies on self consciousness says gibbons are the nearest to human in this respect. Apes and orangutans came next. Among domestic animals, dog and other members of canidae family show subtle self consciousness.  Evolution NCERT  Q6.List 10 modern-day animals and using the” internet resources link it to a corresponding ancient fossil. Name both. ANC    Ans: (i) Cockroach, Limulus (king crab), Neopilina, Latimaria (Fish) are fossil that has remain unchanged over years. (ii) ‘Trilobites- fossil arthropods (iii) Lung fishes – connecting link between fishes and amphibians (iv) Peripatus – connecting link between annelids and arthropods . (v) Woody mammoth – ice fossils (vi) Gastropods – mould and cast fossil (vii) Giant elk – amber fossil of asphalt (viii) Dinosaur footprint – imprints  NCERT Solutions of Evolution Class 12  Q7. Practise drawing various animals and plants. Ans: (1) Elephant NCERT Solutions For Class 12 Biology Evolution Q7 (2) Camel NCERT Solutions For Class 12 Biology Evolution Q7.1 (3) Dog NCERT Solutions For Class 12 Biology Evolution Q7.2 (4) Rose NCERT Solutions For Class 12 Biology Evolution Q7.3 (5) Dahlia NCERT Solutions For Class 12 Biology Evolution Q7.4 (6) hibiscus NCERT Solutions For Class 12 Biology Evolution Q7.5  Class 12 Biology Chapter 7 NCERT Solutions  Q8.Describe one example of adaptive radiation.     Ans: Darwin’s finches of the Galapagos islands had common ancestors but now have different types of modified beaks according to their food habits.  Evolution Questions And Answers Class 12 Q9. Can we call human evolution as adaptive radiation? Ans: Yes, human evolution is an example of adaptive radiation as different species of human evolved across different areas of world as they diverged to different areas in following fashion. (i) Hominid introduction occured in Africa and Asia: (ii) Homo habilis lived in Africa – 2 million years ago. (iii) Homo erectus- migrated to Asia and Europe and diverged into 2 species – Java Man and Peking Man. (iv) Similarly Homo erectus – was followed by Homo sapiens. (v) Primitive neanderthal man in Europe gave way to African cromagnon. NCERT Solutions For Class 12 Biology Evolution Q9  Evolution Class 12 NCERT Q10. Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal say horse.     Ans: Evolutionary stages of horse: Eohippus – Mesohippus – Merychippus – Pliohippus – Equus. Evolutionary trend: (i) Increase in body size. (ii) Elongation of neck. (iii) Lengthening of limbs. (iv) Enlargement of third digit. (v) Increase in structural complexity of teeth for feeding on grass.  Human Health and Diseases

1. Why is reproduction essential for organisms?

Ans: Reproduction is the ability of living organisms to produce a young one similar to itself. It ensures continuity of a species generation after generation. Reproduction introduces variation in the organisms. Useful variations are essential for adaptation and evolution. Therefore, it is essential for organisms.

2. Which is a better mode of reproduction sexual or asexual? Why?


Ans: Sexual reproduction is a better mode of reproduction because of the following reasons:

  1. Variation : Since fusion of gametes from different parents occur during sexual reproduction, hence genetic recombination takes place causing variations.
  2. Evolution : Variation being a major factor of natural selection, therefore, it plays an important role in evolution.
  3. Adaptation : The offspring produced due to sexual reproduction adapt better to the changing environmental conditions.
  4. Vigour and Vitality : Genetic recombination, interaction, etc. during sexual reproduction provide vigour and vitality to the offspring.

3. Why is the offspring formed by asexual reproduction referred to as clone?

Ans:


 Asexual reproduction is a type of reproduction in which a single individual is capable of producing offspring. These offspring are not only genetically and morphologically similar to one another but also similar to their parent. Clone is the term given to individuals that are genetically and morphologically similar. Thus the offspring produced by asexual reproduction are called clones.

4. Offsprings formed due to sexual reproduction have better chances of survival. Why? Is this statement always true?

Ans: The offsprings obtained from sexual reproduction have better chances of survival because the genetic material of such organisms are formed from both the parents. Daughter organisms/offsprings show variation that leads to the evolution of species.

This statement is always true. The offspring produced due to sexual reproduction adapt better to the changing environmental conditions. Genetic recombination, interaction, etc. during sexual reproduction provide vigour and vitality to the offspring.

5. How does the progeny formed from asexual reproduction differ from those formed by sexual reproduction?

Ans: Production of offspring by a single parent without the formation and fiision of gametes is called asexual reproduction. It involves only mitotic cell division that gives rise the daughter cells which are genetically identical to the parent cell. Sexual reproduction is the production of offspring by two parents, male and female. It involves meiotic cell divisions producing haploid nuclei which on fusion produce offspring that are genetically different from their parents.

6. Distinguish between asexual and sexual reproduction. Why is vegetative reproduction also considered as a type of asexual reproduction?



Ans: The difference between asexual and sexual reproduction are as follows :

NCERT Solutions For Class 12 Biology Reproduction in Organisms Textbook Questions Q6
In plants asexual reproduction is called vegetative reproduction because vegetative plant parts like rhizome, runner, sucker, tuber, bulb all are capable of producing off springs These parts give rise to daughter individuals without the involvement of two parents.


7. What is vegetative propagation? Give two suitable examples.

Ans: Vegetative propagation is the formation of new plants from vegetative units. In plants, the units of vegetative propagation are runner, rhizome, sucker, tuber, offset, bulb, etc. These are capable of producing new offsprings. These structures are called v vegetative propagules.

Modified tuberous roots of sweet potato, tapioca, yam, Dahlia and Tinospora can be propagated vegetatively when planted in soil. Small plants emerging from the buds (called eyes) of the potato tuber, from the rhizomes of banana and ginger are other examples.

8. Define:



(a)Juvenile phase

(b)Reproductive phase

(c)Senescent phase.

Ans: (a)Juvenile phase : All organisms have to reach a certain stage of growth and maturity in their life before they can reproduce sexually. That period of growth is called juvenile phase. However, this phase is known as vegetative phase in plants. This phase is of different durations in different organisms.

(b)Reproductive phase: The end of juvenile/ vegetative phase marks the beginning of reproductive phase. During this phase, the organisms produce offspring. In higher plants, this phase can be easily seen when they come to flower but in animals, the juvenile phase is followed by morphological and physiological changes prior to active reproductive behaviour. The reproductive phase is also of variable period in different organisms like some plants, flower throughout the year while others show seasonal flowering. In animals like birds lay eggs seasonally “but when in captivity (as in poultry farms) can be made to lay eggs throughout the year. Placental female mammals, undergo cyclical changes in reproductive organs during this phase.

(c) Senescent phase: It begins from the end of the reproductive phase. During this phase of life span, there is progressive deterioration in the body (like slowing of metabolism, etc.). Old age ultimately leads to death.

9. Higher organisms have resorted to sexual reproduction in spite of its complexity. Why?


Ans: Higher organisms have resorted to sexual reproduction in spite of its complexity because sexual reproduction results in multiplication and perpetuation of species and also contributes to evolution of species by introducing variation much more faster than asexual reproduction in a particular population. Sexual reproduction enables higher organisms to survive during unfavourable conditions.

10. Explain why meiosis and gametogenesis are always interlinked?

Ans: Gametogenesis is the process of formation of two types of haploid gametes (male and female). In gametogenesis, gametes are haploid in number and formed by meiosis so the chromosome number is haploid. Thus gametogenesis is always linked with meiosis.

11. Identify each part in a flowering plant and write whether it is haploid (n) or diploid (2n).

(a)Ovary ————————




(b)Anther ————————

(c)Egg ————————

(d)Pollen ————————

(e)Male gamete ————————

(f)Zygote ————————

Ans: (a)2n (b)2n (c)n (d)n (e)n (f)2n

12. Define external fertilization. Mention its disadvantages.

Ans: When fusion of the gametes takes place outside the body of the organisms, it is called external fertilization or external syngamy. The external medium like water is required for this form of fertilization. This form, is found in many aquatic animals like fishes, amphibians, majority of algae.

In this, parents release eggs and sperms in the surrounding water, then fertilization and development of offspring occur externally. Disadvantages of external fertilization:
(i)if occurs only in aquatic medium.
(ii)A chance factor is involved requiring synchronous release of gametes nearby and absence of turbulence of water.
(iii)There is no protection to young ones. They are vulnerable to a number of predators.

13. Differentiate between a zoospore and a zygote.

Ans: The zoospore is flagellated, motile, haploid or diploid spore formed inside a zoosporangium. It is the result of asexual reproduction.


The zygote is always diploid and formed by the fusion of gametes. It is usually non- flagellated and non-motile or motile. It is the net result of sexual reproduction.

14. Differentiate between gametogenesis from embryogenesis.

Ans: Differences between gametogenesis and embryogenesis are as follows :

NCERT Solutions For Class 12 Biology Reproduction in Organisms Textbook Questions Q14
15. Describe the post-fertilization changes in a flower.

Ans: In sexual reproduction, events that occur after the formation of zygote are called post-fertilization events. In flowering plants, the zygote is formed inside the ovule. After fertilization the sepals, petals and stamens of the flower wither and fall off. But the pistil remains attached to the plant. The zygote develops into the embryo and the ovules develop into the seed. The ovary develops into die fruit that develops.a thick wall called pericarp which is protective in – function. After dispersal, seeds germinate under favourable conditions to produce new plants.

16. What is % bisexual flower? Collect five bisexual flowers from your neighbourhood and with the help of your teacher find out their common and scientific names.

Ans: Flowers in which male and female sex organs (stamens and carpels) are borne on the same flowers are called bisexual flowers. You can observe following bisexual flowers in your kitchen and colony gardens :

(i)Brassica (sarson) – Brassica campestris
(ii)Onion – Allium cepa
(iii)Garden Pea (Edible pea) – Pisum sativum
(iv)Petunia – Petunia hybrida
(v)China rose (shoe flower) – Hibiscus rosa- sinensis.

17. Examine a few flowers of any cucurbit plant and try to identify the staminate and pistillate flowers. Do you know any other plant that bears unisexual flowers?

Ans: The male or staminate flowers of cucurbits bear bright coloured petals and a prominent group of stamens. Male plants or staminate flowers do not bear fruits. The female or pistillate flowers bear fruits. In a fertilised young pistillate flower very small fruit is visible below petals and sepals. Some unisexual plants are : Papaya, Mulberry and Date-palm.


18. Why are offspring of oviparous animals at a greater risk as compared to offspring of viviparous animals?


Ans: On the basis of the development of the zygote, animals are grouped into oviparous and viviparous. The oviparous animals such as reptiles and birds lay eggs. Their fertilised eggs are covered by hard calcareous shell and are laid in a safe place in the environment. After incubation period, young ones hatch out. In viviparous animals such as majority of mammals including human beings, the zygote develops into a young one inside the body of the female individual. After a certain growth period, the young ones are delivered by the female individual. Due to proper care and protection, the chances of survival of young ones are more in viviparous individuals. Oviparous offsprings are at a greater risk than viviparous ones.

TBSE Tripura Class 12 History Suggestion 2023

Sexual Reproduction in Flowering Plants 

1. Name the parts of anangiosperm flower in which development of male and female gametophytes take place.


Ans: Development of male gametophyte (micro- gametogenesis) occurs in pollen sac of anther up to 2 – celled stage. The female gametophyte develops (megagametogenesis) in the nucellus of ovule.

2. Differentiate between microsporogenesis and megasporogenesis. Which type of cell division occurs during these events? Name the structures formed at the end of these two events?

Ans: Differences between microsporogenesis and megasporogenesis are as follows –

NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q2
Each microspore mother cell and megaspore mother cell contain two sets of chromosomes and are therefore diploid. The diploid megaspore mother cell and microspore mother cell enlarges and undergo meiosis to produce, four haploid cells called megaspores and microspores respectively.The chromosome number is reduced by half and therefore megaspores and microspores are haploid.
Microsporogenesis and megasporogenesis give rise to pollen grains and embryo sac respectively. Pollen grain is the male gametophyte and embryo sac represents the female gametophyte.

3. Arrange the following terms in the correct development sequence: Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes.
Ans: The correct developmental sequence for the formation of male gametes is :
Sporogenous tissue —» Pollen mother cell —» Microspore tetrad —» Pollen grain —» Male gametes.

4. With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.



Ans:
NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q4

A typical angiospermic ovule is a small structure which is formed in the ovary. Ovule first develops as a projection on the placenta and composed of multilayered cellular tissue called the nucellus. The hypodermal cell of die nucellus enlarges and transformed into megaspore mother cell. This cell undergoes meiosis to produce four haploid cells only one of which develops & forms embryo sac (female gametophyte). An ovule may be surrounded by one or two protective layers called integuments, leaving a small opening at one end termed as micropyle which acts as passage for the entry of the pollen tube into the ovule. Thus, a typical ovule consists of a fully developed embryo sac with the nucellus and integuments.

5. What is meant by monosporic development of female gametophyte?
Ans: In majority of flowering plants one of the megaspores is functional while the other three degenerate. Only the functional megaspore develops into the female gametophyte or embryo sac. This method of development of embryo sac from a single megaspore is called monosporic development.

6. With a neat diagram explain the 7-celled, 8- nucleate nature of the female gametophyte.
Ans:
NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q6

Embryo sac (or female gametophyte) is formed by three successive mitotic divisions that take place in the nucleus of megaspore.
The nucleus of the functional megaspore divides meiotically to form two nuclei which move to the opposite poles, forming the 2-nucleate embryo sac. Two more sequential mitotic nuclear divisions result in the formation of the 4-nucleate and later the 8-nucleate stages of the embryo sac. After the 8-nucleate stage, cell walls are laid down leading to the organisation of the typical female gametophyte or embryo sac. Six of the eight nuclei are grouped together at micropylar and chalazal end and form the egg apparatus and antipodals respectively. The large central cell left over with two polar nuclei. Thus, a typical female gametophyte consists of 7 cells with 8 nucleus.

7. What are chasmogamous flowers? Can cross-pollination occur in deistogamous flowers? Give reasons for your answer.



Ans: Chasmogamous flowers are those flowers which are open with exposed anther and stigma.

Cleistogamous flowers are those flowers which do not open at all. In these flowers, the anthers and stigma lie close to each other, when anthers dehisce in the flower buds, the pollen grains come in the contact with stigma to effect pollination. So these flowers are invariably self-pollinated as the flowers remain closed and there is no chance of cross pollen landing on the stigma. Pollination and seed setting are assured even in the absence of pollinators

8. Mention two strategies evolved to prevent self-pollination in flowers.
Ans: Continued self-pollination decreases the vigour and vitality of a particular race. Thus, flowering plants have developed many devices to discourage self-pollination and to encourage cross-pollination.
Dichogamy and self-sterility are.two most common devices that ensure cross-pollination. Dichogamy – Maturation of anther and stigma at different times in a bisexual flower prevent self-pollination.
Self-sterility (or self-incompatibility) – Due to the presence of self-sterile gene in some flowers, pollen grains do not germinate on the stigma of that flowers. e.g.,- tobacco, potato.

9. What is self-incompatiblility? Why does self-pollination not lead to seed formation in self-incompatible species?

Ans: If a pistil carrying functional female gametes fails to set seeds following pollination with viable and fertile pollen, capable of bringing about fertilisation in another pistil, the two are said to be incompatible, and the phenomenon is known as sexual incompatibility. Sexual incompatibility may be interspecific (between individuals of different species) or intraspecific (between individuals of the same species). The latter is also called self-incompatibility. Self-incompatibility is a gene-physiological process. Incompatibility reactions are controlled by a single gene, called S-gene, which has several alleles. Pollen grains that possess the S-allele common to any one of the two alleles present in the cells of the pistil, will not be functional on that particular pistil. However, every pollen grain having no common S alleles with pistil would be functional on the pistil of a that plant. As self pollens are unable to fertilise the egg to form pmbryo, hence seeds are not formed in self-incompatible species.

10. What is bagging technique? How is it useful in a plant breeding programme?
Ans: It is the covering of emasculated flowers (removal of anthers in bud condition from a bisexual flower by a bag of butter paper or polythene in their bud condition i.e., before anthesis) to prevent contamination of its stigmas with unwanted pollens. When the stigmas of emasculated flowers mature the bags are removed, stigmas are dusted with pollen grains of desired male . plants by means of a presterilized brush and flowers are rebagged till fruit develop. This technique is mainly used in artificial hybridization. Plant breeders often use this technique to prevent the contamination of stigma of the flowers from unwanted pollen grains.

11. What b triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.



 

Ans: Fusion of second male gamete with die two polar nuclei located in the central cell to form the triploid primary endosperm nucleus (PEN) is called triple fusion or vegetative fertilization. This process takes place in the embryo sac. After reaching the ovary, pollen tube enters into the embryo sac from the micropylar end. After penetration, the tip of the pollen tube ruptures releasing the two male gametes. The one male gamete fuses with the egg to form the diploid zygote. This process is called syngamy and the other male gamete fuses with the two polar nuclei to form the triploid primary endosperm & this process is known as triple fusion. These two events of fertilization constitute the process of double fertilization.

12.Why do you think the zygote is dormant for sometime in a fertiUsed ovule?

Ans: The zygote after a period of rest develops into embryo. Most zygotes remain dormant till certain amount of endosperm forms. They do so, to provide assured nutrition to the developing embryo.

13. Differentiate between:
(a)hy pocotyl and epicotyl;
(b)coleoptile and coleorrhiza;
(c)integument and testa;
(d)perisperm and pericarp.
Ans:
NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q13

NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants Q13.1

14. Why is apple called a false fruit? Which Part(s) of the flower forms the fruit?

Ans: Botanically ripened ovary is called a true fruit. The fruits in which thalamus and other floral parts develop along with the ovary are called false fruits. For example – apple, strawberry, cashew etc. In apple the main edible portion of the fruit is the fleshy thalamus. Ovary forms the fruit after fertilization or without fertilization in parthenocarpic fruits.


15. What is meant by emasculation? When and why does a plant breeder employ this technique?

Ans: Removal of stamens or anthers of a bisexual flower without affecting the female reproductive organs is called emasculation. This technique is used in artificial hybridisation. In such crossing experiments it is important to make sure that only the desired pollen grains are used for pollination and the stigma is protected from contamination from unwanted pollens. This is achieved by emasculation and bagging technique. This technique is used to obtain desired variety of seeds.

16. If one can induce parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?



Ans: Parthenocarpic fruits are seedless. They develop from ovary without fertilization. Banana, grapes, oranges, Pineapple, Guava, Watermelon, lemon are selected because these seedless of units are of high economic importance. The fruits in which seeds or seed part form edible portion (e.g.,Pomegranate) are not selected to induce parthenocarpy.

17. Explain the role of tapetum in the formation of pollen grain wall.



Ans: Tapetum is the innermost wall layer of anther. The cells of this layer have large nuclei and dense cytoplasm. This layer is of great physiological importance as most of the food material from outside passes through this layer. At maturity, these cells degenerate and provide nourishment to developing microspores or pollens inside. Tapetum is the layer, which secretes both enzymes and substances of hormonal nature.

The main function of tapetum is to provide nutrition to pollens but it also secretes some substances of utmost importance like :

  • Qallase enzyme : Tapetum secretes callase enzyme which dissolves callose substances by which four pollens of a pollen tetrad are united, hence separating microspores or pollens of a tetrad.
  • Ubisch bodies : These bodies of lipid nature are also secreted by tapetum. Ubisch bodies get covered with sporopollenin and thus increase thickness of exine (i.e., outer layer of pollen wall). Ubisch bodies are spheroidal and have diameter of only few microns. These are produced only by glandular tapetum (not by amoeboid tapetum).
  • Pollen kit substances : Tapetum also secretes pollen kit, outer most oily, thick, viscous, sticky, electron dense homogeneous coating of pollen grains of many entomophilous plants.

18. What is apomixis and what is its importance?



Ans: Apomixis is a mode of asexual reproduction that produces seeds without fertilization, e.g.- some species of Asteraceae and Grasses. This method is important in hybrid seed industry. Hybrids are extensively cultivated for increasing productivity. But the main drawback is that the hybrid seeds are to be produce every year because the seeds of the hybrid plants da not maintain hybrid characters for longer period due to segregation of characters. This can be avoided if apomixis can be introduced in hybrid seeds. For this reason scientists are trying hard to identify genes for apomixis.

Human Reproduction

1. Fill in the blanks:

(a)Humans reproduce————— (asexually/sexually).

(b)Humans are————— (oviparous, viviparous,ovoviviparous).

(c)Fertilization is————— in humans (external/internal).

(d)Male and female gametes are—————(diploid/haploid).

(e)Zygote is————— (diploid/haploid).

(f)The process of release of ovum from a mature follicle is called————— .

(g)Ovulation is induced by a hormone called—————

(h)The fusion of male and female gametes is called————— .

(i)Fertilization takes place in—————

(j)Zygote divides to form————— which is implanted in uterus.

(k)The structure which provides vascular connection between foetus and uterus is called————— .

Ans: (a) sexually

(b) viviparous
(c) internal
(d)haploid
(e)diploid
(f)ovulation
(g)LH (Luteinizing hormone)
(h)fertilization
(i)ampullary-isthmic junction (fallopian tube)
(j)blastocyst
(k)placenta (Umbilical cord)

2. Draw a labelled diagram of male reproductive system.



Ans:

NCERT Solutions For Class 12 Biology Human Reproduction Q2

3. Draw a labelled diagram of female reproductive system.

Ans:

NCERT Solutions For Class 12 Biology Human Reproduction 1
NCERT Solutions For Class 12 Biology Human Reproduction 2

4. Write two major functions each of testis and ovary.



Ans: Testes are components of both the reproductive system (being gonads) and the endocrine system (being endocrine glands). The respective functions of the testes are – producing sperm (spermatozoa) by the process of spermatogenesis and producing male sex hormones, of which testosterone is the best-known. Testosterone stimulates development of testes and of male secondary sexual characteristics.

The ovaries have two major functions. One is the production of eggs or ova, and the second is the production of hormones or chemicals which regulate menstruation and other aspects of health and well-being, including sexual well-being. Estrogen and progesterone are the most important hormones which serve many functions like, they induce and maintain the physical changes during puberty and the secondary sex characteristics and they support maturation of the uterine endometrium in preparation for implantation for a fertilised egg, etc.

5. Describe the structure of a seminiferous tubule.



Ans: The seminiferous tubule is a structural unit in the adult testis. The seminiferous tubules are situated in testicular lobules. Seminiferous tubule consists of two types of cells – Sertoli or supporting cells & spermatogenic cellsl Sertoli cells, are elongated and pyramidal & partially envelop the spermatogenic cells. The cells provide nourishment to the developing spermatogenic cells. Spermatogenic cells are stacked in 4-8 layers. These cells divide several times & differentiate to produce spermatozoa. Between seminiferous tubules lie the interstitial cells or leydig cells which produces testosterone hormone.


6. What is spermatogenesis? Briefly describe the process of spermatogenesis.



Ans: Spermatogenesis is the process of producing sperms with half the number of chromosomes (haploid) as somatic cells. It occurs in seminiferous tubules. Sperm production begins at puberty continues throughout life with several hundred million sperms be ing produced each day. Once sperm are formed they move into the epididymis, where they mature and are stored. During spermatogenesis one spermatogonium produces 4 sperms. Spermatogenesis completes through the following phases – multiplicative phase, growth phase, maturation phase & spermiogenesis. In multiplicative phase the sperm mother cells divide by mitosis & produce spermatogonia. The spermatogonia grow in size to form large primary spermatocytes by getting nourishment from sertoli cells in growth phase. Maturation phase involves meiosis I in which primary spermatocytes divide to produce secondary spermatocyte and meiosis II which produces spermatids. Thus each primary spermatocyte gives rise to four haploid spermatids. Spermiogenesis or spermateliosis is process of formation of flagellated spermatozoa from spermatids. Spermiogenesis begins in the seminiferous tubules but usually completed in epididymis.

NCERT Solutions For Class 12 Biology Human Reproduction Q6

7. Name the hormones involved in regulation of spermatogenesis.



Ans: The hormones involved in regulation of spermatogenesis are GnRH, LH, FSH and androgens.

Spermatogenesis starts at the age of puberty due to significant increase in the secretion of gonadotropin releasing hormone (GnRH). The increased levels of GnRH then acts at the anterior pituitary gland and stimulates secretion of two gonadotropins – luteinising hormone (LH) and follicle stimulating hormone (FSH). LH acts at the Leydig cells and stimulates synthesis and secretion of androgens. Androgens, in turn, stimulate the process of spermatogenesis. FSH acts on the Sertoli cells and stimulates secretion of some factors which help in the process of spermiogenesis.

8. Define spermiogenesis and spermiation.

Ans: Spermiogenesis is the process of transformation of spermatids into mature flagellated spermatozoa (sperms).Spermiation is the process of release of mature spermatozoa. In this spermatozoa are shed into the lumen of seminiferous tubule for transport.

9. Draw a labelled diagram of sperm.

Ans:

NCERT Solutions For Class 12 Biology Human Reproduction Q9

10.What are the major components of seminal plasma?


Ans: Seminal plasma is the fluid in which sperm is ejaculated. Major components of seminal plasma are secretions from seminal vesicles, prostrate and bulbourethral gland and sperms from testis. It is rich in fructose and contains enzymes, citric acid, hormones like prostaglandins, calcium and clotting proteins.

11. What are the major functions of male accessory ducts and glands?

Ans: Male accessory ducts include rete testis, vasa efferentia, epididymis and vas deferens. These ducts store and transport sperms from the testis to the outside through urethra. The male accessory glands include paired seminal vesicles, a prostate and paired bulbourethral glands. Secretions of these glands constitute the seminal plasma which is rich in fructose, calcium and certain enzymes. The secretions of bulbourethral glands also helps in the lubrication of the penis.

12. What is oogenesis? Give a brief account of oogenesis.

Ans: The process of formation of a mature female gamete (ovum) is called oogenesis. It occurs in the ovaries of female reproductive system. Oogenesis is a discontinuous process it begins before birth, stops in midprocess & only resumes after menarch. It occurs in three phases : Multiplicative phase (formation of oogonia mitotically from the primary germ cells), Growth phase (growth of oogonia into primary oocyte) & Maturation phase (formation of mature ova from primary oocyte through meiosis). Maturation phase produces two haploid cells – Larger one called secondary oocyte & the smaller one called polar bodies (1st polar body). Meiosis II of secondary oocyte results in the formation of functional egg or ovum and a second polar body: The first polar body may also divide to form two polar bodies of equal sizes which do not take part in reproduction & ultimately degenerates. First maturation division may be completed in the ovaries just prior to ovulation but second one (Final) is completed outside the ovary after fertilization. Secondary oocyte is female gamete in which the 1st meiotic division is completed & second meiotic division (Metaphase stage) has begin. The egg is released at secondary oocyte stage under the effect of LH.

NCERT Solutions For Class 12 Biology Human Reproduction Q12

13. Draw a labelled diagram of a section through ovary.



Ans:

NCERT Solutions For Class 12 Biology Human Reproduction Q13

14. Draw a labelled diagram of a Graafian follicle.


Ans:

NCERT Solutions For Class 12 Biology Human Reproduction Q14

15. Name the functions of the following:



(a) Corpus luteum

(b) Endometrium

(c) Acrosome

(d) Sperm tail

(e) Fimbriae

Ans: (a) Corpus luteum : The corpus luteum secretes large amounts of progesterone which is essential for maintenance of the endometriuip.

(b) Endometrium is necessary for implantation of the fertilized ovum and other events of pregnancy.
(c) The acrosome is filled with enzymes that help during fertilization of the ovum.
(d) Sperm tail: Tail facilitates sperm motility which is essential for fertilization.
(e) Fimbriae: Fimbriae help in collection of the ovum after ovulation.

16. Identify True/False statements. Correct each

false statement to make it true.

(a) Androgens are produced by Sertoli cells. (True/False)

(b) Spermatozoa get nutrition from sertoli cells. (True/False)

(c) Leydig cells are found in ovary. (True/ False)

(d) Leydig cells synthesize androgens. (True/ False)

(e) Oogenesis takes place in corpus luteum. (True/False)

(i) Menstrual cycle ceases during pregnancy. (True/False)

(g) Presence or absence of hymen is not a reliable indicator of virginity or sexual – experience. (True/False)

Ans: (a) False, Androgens or male sex hormones (e.g, testosterone) are secreted by Leydig cells.

(b) True.
(c) False, Leydig cells are found in testis.
(d) True.
(e) False, Oogenesis takes place in ovary.
(f) True.
(g) True.

17. What is menstrual cycle? Which hormones regulate menstrual cycle?



Ans: Menstrual cycle is the cyclic change( itf’the reproductive tract of primate female. This period is marked by a characteristic event repeated almost every month (28 days with minor variation) in the form of a menstrual flow (i.e. shedding of the endometrium of the uterus with bleeding. It may be temporarily stopped only in pregnancy.

The hormones that regulates menstrual cycles are
(i) FSH (Follicle stimulating hormone),
(ii) LH (Luteinizing hormone),
(iii) Oestrogens,
(iv) Progesterone.

18. What is parturition ? Which hormones are involved in induction of parturition?



Solution:

Parturition (or labour) means child birth. Parturition is the sequence of actions by which a baby and the afterbirth (placenta) are expelled from the uterus at childbirth. The process usually starts spontaneously about 280 days after conception, but it may be started by artificial means.

The process of parturition is induced by a complex neuroendocrine mechanisms involving cortisol, estrogen and oxytocin.

19. In our society the women are often blamed for giving birth to daughters. Can you explain why this is not correct?

Ans: The sex chromosome pattern in the human females is XX and that of male is XY. Therefore, all the haploid female gametes (ova) have the sex chromosome X, however, the haploid male gametes have either X or Y. Thus 50% of sperms carry the X-chromosome while the other 50% carry the Y-chromosome. After fusion of the male and female gametes, the zygote carries either XX or XY depending upon whether the sperm carrying X or Y fertilizes the ovum. The zygote carrying XX would be a female baby and XY would be a male baby. That is why it is correct to say that the sex of the baby is determined by the father.

20. How many eggs are released by a human ovary in a month? How many eggs do you think would have been released if the mother gave birth to identical twins? Would your answer change if the twins born were fraternal?



Ans: One egg is released by human ovary in a month. Identical twins: Identical twins are formed when a single fertilized egg splits into two genetically identical parts. The twins share the same DNA set, thus they may share many similar attributes. However, since physical appearance is influenced by environmental factors and not just genetics, identical twins can actually look very different.

Fraternal twins: These twins are formed when two fertilized eggs are formed. The twins share the different DNA set, thus they may share different attributes (dizygotic embryo).

21. How many eggs do you think were released by the ovary of a female dog which gave birth to 6 puppies?

Ans: Since dogs have multiple births, several eggs mature and are released at the same time. If fertilised, the egg will implant on the uterine wall. Dogs bear their litters roughly 9 weeks after fertilisation, although the length of gestation can vary from 56 to 72 days. An average litter consists of about six puppies, though this number may vary widely based on the breed of dog. On this basis 6 eggs were released by the ovary of a female dog which gave birth to 6 puppies.

Reproductive Health

1. What do you think is the significance of reproductive health in a society?

Ans: Reproductive health in a society is significant because the people are aware of

(i) birth control methods and advantages of small family,
(ii) sexually transmitted diseases and methods to avoid them,
(iii) importance breast feeding and post natal care of the mother and baby and
(iv) equal opportunities for the male and female children.

2. Suggest the aspects of reproductive health which need to be given special attention in the present scenario.

Ans: The aspects of reproductive health which need to be given special attention are :

  • Introduction of sex education in schools to give right information to the young minds about reproductive organs, accessory organs of reproduction, secondary sexual characters, adolescence and related changes, safe and hygienic sexual practices, STDs etc.
  • Providing knowledge about available birth control methods, care of pregnant mothers, post-natal care of the mother and child, importance of breast feeding etc.
  • Creating awareness about consequences of uncontrolled population growth and social evils (sex abuses and sex-related crimes, use of drugs, tobacco and alcohol etc.) among young people.

3. Is sex education necessary in schools? Why?


Ans: Yes, sex education is necessary in school. Because introduction of sex education in school encourage to provide the right or correct information to the young peoples so as to discourage children from believing in myths & having misconceptions about sex related aspects. Proper information about reproductive organs, safe & hygienic sexual practices, STD’s etc. would help people, those in the adolescent age group to lead a healthy reproductive life. In many countries, sexual education raises much contentious debate. Chief among the controversial points is whether covering child sexuality is valuable or detrimental; the use of birth control such as condoms and hormonal contraception, and the impact of such use on pregnancy, outside marriage, teenage pregnancy, and the transmission of STDs. Increasing support for abstinence – only sex education by conservative groups has been one of the primary causes of the controversies.

4. Do you think that reproductive health in our country has improved in the past 50 years? If yes, mention some such areas of improvement



Ans: Yes, in the last 50 years, reproductive health in our country has improved. Some such areas of improvement are (i) massive child immunization (ii) maternity and child health (iii) increasing use of contraceptives (iv) family planning.

Bringing sexual and reproductive health services to the millions of people living in countries which still suffer from short life expectancies, high levels of child and maternal mortality, child lSS&ur and illiteracy and poor overall health remains a major challenge for governments and non government organizations.

5. What are the suggested reasons for population explosion?

Ans: (i) Increased health facilities along with better living conditions had an explosive impact on the growth of population.

(ii) Decline in Death rate
(iii) Decline in Maternal Mortality Rate
(iv) Decline in Infant Mortality Rate
(v) Increase in the number of people in the reproductive age.

6. Is the use of contraceptives justified ? Give reasons.

Ans: Population in India is increasing at a very fast rate and such a growth necessitated intense use of contraceptive methods to bring all the fertile couples under its cover. It will help in bringing the birth rate down and consequently check the population growth. Therefore, the use of contraceptives is justified. It is essential to mention here that the selection of a suitable contraceptive method should be practiced in consultation with qualified doctors. The government provides these facilities free at the family planning centres. Contraceptives are given free or at nominal prices at these centres to the couples of reproductive age desirous of preventing conception.

7. Removal of gonads cannot be considered as a contraceptive option. Why?



Ans: Removal of gonads or its parts is a surgical method, of sterilization. Vasectomy and tubectomy are carried out in males and females respectively. It will lead to infertility & both male and female will be dependent on hormones in their remaining life to regulate functioning of reproductive organs. These are very effective but their irreversibility is very poor, so they are not good options for contraception.

8. Amniocentesis for sex determination is banned? in our country. Is this ban necessary? Comment

Ans: Since Amniocentesis is misused to find out the sex of the foetus leading to female foeticides, it is necessary. It is the prenatal diagnostic

technique, that helps to find out chromosomal (genetic) disorders, metabolic disorders of the foetus; in extreme cases where the foetus is found to be suffering from an incurable disorder Medical Termination of Pregnancy (MTP) is banned. The solution to the problem is not ‘ passing more laws, such as banning sex determination ultrasounds but raising the social & economic status of women, 9. Suggest some methods to assist infertile couples to have children.

Ans: ART (Assisted Reproductive Technologies) is a term that describes several different methods used to help infertile couples. ART involves removing eggs from a woman’s body, mixing them with sperm in the laboratory and putting the embryos bath into a woman’s body.
Success rates vary depending on many factors.Something that affects the success rate of ART includes age of the partners, reason for infertility,type of ART, if the egg is fresh or frozen. Various methods are now available to help such couples are — in vitro fertilization, gamete intra fallopian transfer, intracytoplasmic sperm injection & artificial insemination.
(i) In vitro fertilization – Patient’s egg & her partner’s sperm are collected & mixed together in a laboratory to achieve fertilization outside the body. The embryo produced may then be transferred into the female patient. It is commonly knownas test tube baby programme.
(ii) Gamete Intra Fallopian Transfer (GIFT) – A procedure in which eggs are retrieved from a woman, mixed with sperm & immediately replaced in one or other of the women’s fallopian tubes so that they fertilize inside the body (invivo).
(iii) Intra Cytoplasmic Sperm Injection (ICSI)– In this method, sperm & eggs are retrieved from both the parents. A single sperm is injected directly into an egg, then the fertilized egg is implanted into the woman’s uterus.
(iv)Artificial insemination – In this technique, the semen is collected either from husband or a healthy donor & is artificially introduced either into the vagina or into the uterus of the female (IUI-Intra uterine insemination).

10. What are the measures one has to take to prevent from contracting STDs?

Ans: (i) Avoiding sex with unknown partner /multiple partners.

(ii) Always use condoms during intercourse.
(iii) In case of doubt, go for medical professional for early detection and get complete treatment if diagnosed with disease.
(iv) Education & counselling of persons at risk on ways to adopt safer sexual behaviour.

11. State True/False with explanation
(a) Abortions could happen spontaneously too. (True/False)
(b) Infertility is defined as the inability to produce a viable offspring and is always due to abnormalities/defects in the female partner. (True/False)
(c) Complete lactation could help as a natural method of contraception. (True/False)
(d) Creating awareness about sex related aspects is an effective method to improve reproductive health of the people. (True/False)


”

Ans: (a) True. Due to internal factors like incompatibility, abortion could happen spontaneously.
(b)False. It is due to abnormalities/defects in either male or female or both the partners.
(c)True, but it is limited to period up to six months after parturition.
(d)True. Creating awareness about sex-related aspects removes the myths and miconcep- tions about these problems.

12. Correct the following statements:

(a) Surgical methods of contraception prevent gamete formation.

(b )Ail sexually transmitted diseases are completely curable.

(c) Oral pills are very popular contraceptives, among the rural women.

(d) In E.T. techniques, embryos are always transferred into the uterus.

Ans: (a) Surgical methods of contraception prevent gamete transport & thereby prevent conception.

(b) Except for hepatitis-B, genital herpes, and HIV infections, other STD diseases are completely curable if detected early and treated properly.
(c) Oral pill are very popular contraceptives among the educated urban women.
(d) In E.T. techniques, embryos with 8 blastomeres are transferred into fallopian tube and more than 8 blastomeres are transferred into the uterus.

Principles of Inheritance and Variation

1.Mention the advantages of selecting pea plant for experiment by Mendel
Ans: Mendel select garden pea (Pisum Sativum) for the following reasons.
(i) It is an annual plant with short life span and gives results within 3 months.
(ii) The plant is grown easily and does not require after care except at the time of pollination.
(iii) F1 hybrids are fertile.
(iv) Seven pairs of contrasting characters easily detectable.
(v) True breeding self pollination.

2. Differentiate between the following –



(a) Dominance and Recessive
(b) Homozygous and Heterozygous
(c) Monohybrid and Dihybrid.
Ans: (a)The difference between dominance and recessive me:
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q2
(b) Differences between homozygous and heterozygous individuals :
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q2.1
(c) In breeding experiments when a cross is made between the individuals considering their same single character, it is called mono¬hybrid cross, while a cross is done consid¬ering two characters at fee same time is called dihybrid cross (Yellow Round * Green Wrinkled).

3. A diploid organism is heterozygous for 4 loci, how many types of gametes can be produced?




Ans: For a diploid organism, which is heterozygous for 4 loci, then 24 i.e. 2 x 2 x 2 x 2 = 16 types of gametes can be produced if the genes are not linked because for each heterozygous pair of genes there are two possibilities. So, for 4 pair the number of combination will be 16 gametes.

4. Explain the Law of Dominance using a monohybrid cross.
Ans: When two different factors (genes) or a pair of contrasting forms of a character are present in an organism, only one expresses itself in the F, generation and is termed as dominant while the other remains unexpressed and called recessive factors (gene).
A tall (TT) true breeding plant is crossed with a dwarf (tt) plant. The character of height is represented by‘T’ for tall‘t’ for dwarf are the alternate form as character of height. The Fj hybrid ‘Tt’ is Tall, showing that tall is dominant over dwarf while dwarf remains unexpressed in F, offspring due to phenomenon of dominance by tall factor or gene.In this Tt heterozygous has tall phenotype showing T is dominant over t allele.
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q4

5. Define and design a test-cross.
Ans: When an individual is crossed with the homozygous recessive parent. It is called test cross.
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q5
Test cross helps in establishing hetero/ homozygosity of dominant trait.

6. Using a Punnett Square, workout the distribution of phenotypic features in the first filial generation after a cross between a homozygous female and a heterozygous male for single locus.




Ans:
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q6
Phenotype: All tall
Genotype ratio : TT: Tt 2:2 or 1:1

7. When a cross is made between tall plant with yellow seeds (TtYy) and tall plant with green seed (Ttyy), what proportions of phenotype in the offspring could be expected to be
(a)tali and green.
(b)dwarf and green.
Ans: A cross between tall plant with yellow seeds (TtYy) & tall plant with green seed (Ttyy) is given below.
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q7

8. Two heterozygous parents are crossed. If the two loci are linked what would be the distribution of phenotypic features in F1 generation for a dihybrid cross?




Ans: Consider 2 characters Blue (B), long (L) seeds of a plant – both characters linked.
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q8

9. Briefly mention the contribution of T.H. Morgan in genetics.
Ans: Thomas Hunt Morgan (1866-1945), an American geneticist and Nobel Prize winner of 1933, is considered as “Father of experimental genetics” for his work on and discovery of linkage, crossing over, sex linkage, criss cross inheritance, linkage maps, mutability of genes, etc. He is called fly man of genetics because of selecting fruit fly (Drosophila melanogaster) as research, material in experimental genetics. It was largely due to his book, “The Theory of Gene”, that genetics was accepted as a distinct branch of biology. In 1910, he discovered linkage and distinguished linked and unlinked genes. Morgan and Castle (1911) proposed “Chromosome Theory of Linkage” showing that genes are located on the chromosomes and arranged in linear order. Morgan and Sturtevant (1911) found that frequency of crossing over (recombination) between two linked genes is directly proportional to the distance between the two. 1% recombination is considered to be equal to 1 centi Morgan (cM) or 1 map unit. He worked on sex linked inheritance and reported a white eyed male Drosophila in a population of red eyed and proved that gene of eye colour is located on X-chromosome. The male passed its genes on X-chromosomes to the daughter while the son gets genes on X-chromosome from the female (mother): It is called criss-cross inheritance.

10. What is pedigree analysis? Suggest how such an analysis, can be useful.


 



Ans: Pedigree analysis is study of pedigree for the transmission of particular trait and finding the possibility of absence or presence of that trait in homozygous or heterozygous state in a particular individual. Pedigree analysis helps-
(i) in analysis of transmission of character in family over generation.
(ii) in genetic counselling of disease like haemophilia.
(iii) to identify whether a particular genetic disease is due to recessive gene or a dominant gene.
(iv) to identify the possible origin of the defective gene in the family or in a population.

11. How is sex determined in human beings?
Ans: Sex determination refers to the mechanisms employed by organisms to produce offsprings that are of two different sexes. The sex of an individual is determined by the genetic information present in the individual’s sex chromosomes. Sex determination in human is done by XY type chromosome. In humans, females have two XX chromosomes and males have two different chromosomes (XY).

12. A child has blood group O. If the father has blood group A and mother of blood group B, work out the genotypes of the parents and the possible genotypes of the other off springs.


 


Ans:
NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation Q12

13. Explain the following terms with example
(a) Co-dominance
(b) Incomplete dominance
Ans: (a) Codominance : Codominance is the phenomenon of two contrasting alleles of the same gene lacking dominant recessive ratio and expressing themselves simultaneously when present together. E.g. ABO blood group system – Human blood group AB is formed when alleles of blood groups A and B are present together (IAIB). Such RBCs carry both antigen A & B showing that both die alleles are expressing their effect phenotypically & codominant.
(b) Incomplete dominance : Incomplete dominance may be defined as the partial /expression of both alleles in a heterozygote so that the phenotype is intermediate between those of two homozygotes. In this none of the allele is completely dominant, e.g., Pink colour flower in dog flower. In Mirabilis jalapa & Snapdragon or dog flowers, there are two types of flower colour in pure state-red & white. When the two types of plant are crossed, the hybrid or plants of Fj generation have pink flowers. The pink colour apparently appears either due to mixing of red & white colours (incomplete dominance) or expression of a single gene for pigmented flower which produces only pink colour.

14. What is point mutation? Give one example.


 


Ans: Mutations arising due to change in single base pair of DNA is called point mutation. Eg., sickle cell anaemia, haemophilia.

15. Who had proposed the chromosomal theory of the inheritance?
Ans: Chromosomal theory of inheritance was proposed by Sutton and Boveri independently in 1902. The two workers found a close similarity between the transmission of Mendelian hereditary factors (genes) and behaviour of chromosomes during gamete formation and fertilisation. They proposed that chromosomes were the carriers of the Mendelian factors. It is the chromosome and not genes which segregate and assort independently during meiosis and recombine at the time of fertilisation in the zygote. Chromosomal theory of inheritance was expanded by Morgan, Sturtevant and Bridges.

16. Mention any two autosomal genetic disorders with their symptoms.
Ans: Sickle cell anaemia : Haemoglobin has less 02 transport, sickle shaped RBCs etc.
Phenylketonuria : Mental retardation (due to accumulation of phenylalanine in brain), hypopigmentation of skin & hair, eczema etc.

Molecular Basis of Inheritance

1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Ans: Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Ans: In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Write down the sequence of complementary strand in 5′ —> 3′ direction.
Ans: If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
The sequence of the complementary strand in 5′ —> 3′ direction will be:
5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′

4. If the sequence of the coding strand in a transcription unit is written as follows: 5-ATGCATGCATGCATGCATGCA TGCATGC-3′




Write down the sequence of mRNA.
Ans: mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain
Ans: The antiparallel, double-stranded nature of the DNA molecule led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They suggested that the two strands of DNA molecule uncoil and separate, and each strand serves as a template for the synthesis of a new (complementary) strand alongside it. The template and its complement, then form a new DNA double strand, identical to the original DNA molecule. The sequence of bases which should be present in the new strands can be easily predicted because these would be complementary to the bases present in the old strands. A will pair with T, T with A, C with G, and G with C. Thus, two daughter DNA molecules identical to the parent molecule are formed and each daughter DNA molecule consists of one old (parent) strand and one new strand. Since only one parent strand is conserved in each daughter molecule, this mode of replication is said to be semiconservative. Meselson and Stahl and Joseph Taylor, later proved it by experiments.

6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Ans: (i) DNA dependent DNA polymerase – synthesis.
(ii) DNA dependent RNA polymerase – synthesis.
(iii) RNA dependent DNA polymerase – Retroviral nucleic acid.
(iv) RNA dependent RNA polymerase – cDNA synthesis.

7. How did Hershey and Chase differentiate between DNA and protein in their experiment white proving that DNA is the genetic material?


 


Ans: Alfred Hershey and Martha Chase (1952) worked with viruses that infect bacteria called bacteriophages. In 1952, they chose a bacteriophage known as T2 for their experimental material.
They grew some viruses on a medium that contained radioactive phosphorus (p32) and some others on medium that contained radioactive sulphur (s35). Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protem does not. Similarly, viruses grown on radioactive sulphur contained radioactive protein but not radio’active DNA because DNA does not contain sulphur.
Radioactive phages were allowed to attach to E. coli bacteria. Then, as the infection proceeded, the viral coats were removed from the bacteria by agitating them in a blender. The virus particles were separated from the bacteria by spinning them in a centrifuge. ,
Bacteria which was infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This indicates that proteins did not enter the bacteria from the viruses. DNA is therefore the genetic material that is passed from virus to bacteria.

8. Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNAand tRNA
(c) Template strand and Coding strand
Ans: (a) The main differences between repetitive DNA and satellite DNA are as following:
(b) The main difference between mRNA and tRNA are as following:
(c) The main difference between template strand and coding strand are as follows :

9. List two essential roles of ribosome during translation.
Ans: Two essential roles of ribiosomes during translation are ;o
(i) they provide surface for binding of mRNA in the groove of smaller sub unit of ribosome.
(ii) As larger sub unit of ribosome has peptidy transferase on its ‘P’ site, therefore, it helps in joining amino acids by forming peptide bonds. .

10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then why does lac operon shut down some time after addition of lactose in the medium?


 



Ans: Lac operon is switched on, on adding lactose in medium, as lactose acts as inducer and makes repressor inactive by binding with it. When the lac operon system is switched on, β-galactosidase is formed, which converts lactose into glucose and galactose. As soon as all the lactose is consumed, repressor again becomes active and causes the system to switch off (shut down).

11. Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA

(c) Exons
Ans: Promoter: It is one of the three components of a transcription unit that takes part in transcription. It is located at the start 5′ end and provides site for attachment of transcription factors (TATA Box) and RNA polymerase. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome for their taking part in protein formation.
Exons: In eukarytoes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are transcribed and translated both.

12. Why is the Human genome project called a mega project?
Ans: Human genome project is called a mega project because
(i) it required bioinformatics data basing and other high speed computational devices for analysis, storage and retrieval of information.
(ii) it generated lot of information in the form of sequence annotation.
(iii) it was carried out in number of labs and coordinated on extensive scale.

13. What is DNA fingerprinting? Mention its application.


 


Ans: DNA fingerprinting or DNA typing is a technique of determining nucleotide sequences of certain areas (VNTRs) of DNA which are unique to each individual. Each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue and organ of a person. It cannot be changed by any known treatment. Applications of DNA fingerprinting are as follows:

  • Paternity disputes can be solved by DNA fingerprinting.
  • DNA fingerprinting technique is being used to identify genes connected with hereditary diseases.
  • It is useful in detection of crime and legal pursuits.
  • It can identify racial groups, their origin, historical migrations and invasions.

14. Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics

Ans: Transcription : It is DNA directed synthesis of RNA in which the RNA is transcribed on 3*—>5’ template strand of DNA in 5’—>3’ direction. Polymorphism: Variation at genetic level arisen due,to mutation, is called polymorphism. Such variations are unique at particular site of DNA, forming satellite DNA. The polymorphism in DNA sequences is the basis of genetic mapping and DNA finger printing.
Translation : Protein synthesis from mRNA, tRNA, rRNA.
Bioinformatics : Computational method of handling and analyzing biological databases.

Evolution

Evolution Chapter Class 12 NCERT  Q1. Explain antibiotic, resistance observed in bacteria in light of Darwinian selection theory.


 


Ans: According to Darwin, environment selects organisms with favourable variations and these organisms are allowed to survive. When a bacterial population encounters a particular antibiotic, those sensitive to it die. But some bacteria having mutations become resistant to the antibiotic. Such resistant bacteria survive and multiply quickly as the competing bacteria have died. Some the resistance providing genes become widespread and entire bacterial population becomes resistant.

Evolution Class 12 NCERT Solutions Q2. Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution
Ans: New fossil discoveries are as follows :

1. An international research team has recently discovered some amber fly specimens in El Sopalo cave (Cantabria, Spain). According to an article published in the scientific journal ‘Current Biology’, these specimens fed on nector and pollinated gymnosperm plants 105 million years ago.

2. Research conducted in Japan has revealed a very unusual new species of octocoral from a shallow coral reef in Okinawa, Japan. This new species can be considered as “living fossil,” and is related in many ways to the unusual blue coral.

3. The 48 million year old fossil, recovered from the Bridger Formation in Wyoming, is the first description of a new species, named Babibasiliscusalxiby the author, and
may represent the earliest clear member of the lizard group, Corytophanidae.

4. Neanderthals became extinct about 40,000 years ago but contributed on average one to three percent to the genomes of present day Eurasians. Researchers have now analysed DNA from a 37,000 to 42,000 year old human mandible in Romania and have found that six to nine percent of this person’s genome came from Neanderthals, more than any other human sequenced till date. Because large segments of this individual’s chromosomes are of Neanderthal origin, a Neanderthal was among his ancestors as recently as four to six generations back in his family tree. This shows that some of the first modern humans that came to Europe mixed with the local Neanderthals.

Chapter 7 Biology Class 12 NCERT Solutions Q3. Attempt giving a clear definition of the term species.



Ans: Species is population or group of individuals that have potential of interbreeding and are able to produce viable, fertile young ones but are reproductively isolated from members of other species.

Evolution NCERT Solutions  Q4. Try to trace the various components of human evolution (hint: brain size and function, skeletal structure, dietary preference, etc.)
Ans:
NCERT Solutions For Class 12 Biology Evolution Q4
Dietary preference:
Dryopithecus and Ramapithecus — herbivores Australopithecus Africans, Homo Carnivores habilis
Homo erectus, Homo sapinens — Omnivores

Evolution NCERT Solutions Class 12  Q5. Find out through internet and popular science articles whether animals other than man has self-consciousness.
Ans: Recent studies on self consciousness says gibbons are the nearest to human in this respect. Apes and orangutans came next. Among domestic animals, dog and other members of canidae family show subtle self consciousness.

Evolution NCERT  Q6.List 10 modern-day animals and using the” internet resources link it to a corresponding ancient fossil. Name both. ANC 


Ans: (i) Cockroach, Limulus (king crab), Neopilina, Latimaria (Fish) are fossil that has remain unchanged over years.
(ii) ‘Trilobites- fossil arthropods
(iii) Lung fishes – connecting link between fishes and amphibians
(iv) Peripatus – connecting link between annelids and arthropods .
(v) Woody mammoth – ice fossils
(vi) Gastropods – mould and cast fossil
(vii) Giant elk – amber fossil of asphalt
(viii) Dinosaur footprint – imprints

NCERT Solutions of Evolution Class 12  Q7. Practise drawing various animals and plants.
Ans: (1) Elephant
NCERT Solutions For Class 12 Biology Evolution Q7
(2) Camel
NCERT Solutions For Class 12 Biology Evolution Q7.1
(3) Dog
NCERT Solutions For Class 12 Biology Evolution Q7.2
(4) Rose
NCERT Solutions For Class 12 Biology Evolution Q7.3
(5) Dahlia
NCERT Solutions For Class 12 Biology Evolution Q7.4
(6) hibiscus
NCERT Solutions For Class 12 Biology Evolution Q7.5

Class 12 Biology Chapter 7 NCERT Solutions  Q8.Describe one example of adaptive radiation.


 


Ans: Darwin’s finches of the Galapagos islands had common ancestors but now have different types of modified beaks according to their food habits.

Evolution Questions And Answers Class 12 Q9. Can we call human evolution as adaptive radiation?
Ans: Yes, human evolution is an example of adaptive radiation as different species of human evolved across different areas of world as they diverged to different areas in following fashion.
(i) Hominid introduction occured in Africa and Asia:
(ii) Homo habilis lived in Africa – 2 million years ago.
(iii) Homo erectus- migrated to Asia and Europe and diverged into 2 species – Java Man and Peking Man.
(iv) Similarly Homo erectus – was followed by Homo sapiens.
(v) Primitive neanderthal man in Europe gave way to African cromagnon.
NCERT Solutions For Class 12 Biology Evolution Q9

Evolution Class 12 NCERT Q10. Using various resources such as your school library or the internet and discussions with your teacher, trace the evolutionary stages of any one animal say horse.


 


Ans: Evolutionary stages of horse:
Eohippus – Mesohippus – Merychippus – Pliohippus – Equus.
Evolutionary trend:
(i) Increase in body size.
(ii) Elongation of neck.
(iii) Lengthening of limbs.
(iv) Enlargement of third digit.
(v) Increase in structural complexity of teeth for feeding on grass.

Human Health and Diseases






Leave a Reply

Your email address will not be published. Required fields are marked *

This website uses cookies and asks your personal data to enhance your browsing experience. We are committed to protecting your privacy and ensuring your data is handled in compliance with the General Data Protection Regulation (GDPR).